ZFIN ID: ZDB-TSCRIPT-160112-914
Transcript Name: trmt10b-202
Previous Name: trmt10b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain:
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000063129 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000063129|OTTDARG00000043520| trmt10b|OTTDARP00000049363 trmt10b-001 LG_1 CABZ01030286.1,CABZ01030285.1,CABZ01030284.1 Danio rerio protein_coding KNOWN, 1318 bp
GACGTCATAACCTTGCGCCATTCTAACGACTTTCCAAAAC
ACTTGCAGCAGTGGCTTGTTTTCGTGTTGTTTTCGACCCT
TTGTTTATGTTTTTAACACACGTTTACATGTTTGTGGTTT
ATCAGTTACTCGTCGCTTTCGCGGAGACCTTCAGCAGTGT
AAAAACACAGTACTTTCACTTTATCAGTCTCGTGATGTTT
GTCATGACATAAATATAATGGTTTTTTCGTTGTTTTCGGC
AGAATATACGGTCTTTTATTTTTAGACATCCAAGCAGATG
GAGGAACAGCTTCGTGTAGGTGGCTGTTCTCCGGACGGTG
GGTTTACTATAGTAAACGAGGCTCCGGTCGCGGATTTACT
GGAGTTTCTGCACATTGACGTGGAGCTCGAGCACGCGCGT
GACGACAGAGAGGAGAGCGCGCGCTCGAAAAATGTAATGC
GGAAACAGCGTAACTGGGAGAGAAGACTGGAGGTGAAAAA
AAGCAAAAGGAAAGAGGAGAAACTAAGGAAGAAGCTCAAC
AGACAAGATAAAGATGTGAGTGACGCACAGCTCAGTAAAC
GCGTCATTAAAGCCATCACCAAAGAGAGACTGGAGGAGGC
GCGAGCAGCAGGACTGCGTCTGTGTGTGGACCTCAGCATG
ACTGAACATCTCACACACAAGGAAATCAGTCGTCTTGCGG
CTCAGATCAGACGCCTCTATGGATCCAATAAAAAGGCCTT
GCAGCCGTTCCACGTTTTCCTGACGGAGCTACAAGAGGAC
AGTCTGCTGTATAAGGAGTGTGTCCGGATGAATGACGGCT
TCATGCATTACTTGATTGATGTGACGGAGGAGAGCTGGTT
TCATCTATTTCCCTCTGAAGATGTGATATATTTAACTCCG
GACGCAAGCGAAGCTCTAGAAAGCGTGGAGGAAGATAAAA
TCTACATCCTTGGAGGTTTAGTGGATGAAACCATACAGAA
GAAAATAAGCTACACGAAGGCCAAAGAGCTCGGTGTTCGC
ACAGCACGACTGCCTATTGATGAGTACATGGTGAAGAAAA
AAAACCCCAAAAACTTCCACTCCAAAATCCTGGCCATCAA
CCAAGTGTTTGATATCCTCCTGACATTTCGGGACACCAGA
GATTGGACTAAAGCTCTTATGGCAGGAATCCCTCCTGGAA
AAGGATTTGTTTTGGCATCGGCAGCGTCTAAACCTCTGGA
AGAGACGTAGACACTCACAGGCTTTCATTTGACAGCGTTC
ATCAGTATATATTAACAGTCAGTGTGTGCGTGCGTGCGAG
CGTGCATGCGTGCGTGCAAGCGTGCGTGCGTGCATGCG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS

Genome Resources: Vega_Trans:OTTDART00000063129 (1),  Ensembl_Trans:ENSDART00000173079 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124659 (1) 2008 nt
CITATIONS (2)