ZFIN ID: ZDB-TSCRIPT-160112-872
Transcript Name: cbln11-201
Previous Name: cbln11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062999 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062999|OTTDARG00000043417| CH211-63P21.7|OTTDARP00000049258 CH211-63P21.7-001 LG_ CT027762.14 Danio rerio protein_coding NOVEL, 936 bp
ATTTCCCCCAATGCAAGCAGCAAATCTGACTTCATGATCC
AAATACTCCACATTAATAATAATTAACCAGCAGTGGCTGT
ATATACAAAGCACAGCCTTCGCTTTTCTGTTCAGCTCTAG
AGAAACGATCGTCATGGCTTTATTTCAGATCTTCTTGATC
TCAGCGTTGAGTTTCTGTGCGGCACAGGATGACGATATTA
TGACTCCTGTGGTGAATATCAACTCTGAGCTAAAAGAGCT
GAAAGCTTCAATTGCTGAGCTAAAAACAGATCTGATCACT
GCTAAAAATGAACTACAAGAACAGAACAGCTTGATTCAGG
ACCTGCGGAAACAGATTAAAGAGAGTCCTAAAGTGGCGTT
CACTGCCTCCATGTCAGAGACGCAGAGTGCAAGCCGAGGG
CCGTACACTACAGAGACCAAACTCATCTTTGATAAAGTCT
TAACCAATGTTGGAGATGCGTACAACCCTGCCACAGGAGT
TTTCACCGCACCAGTTAAAGGTGTGTATTACTTCAGGTAC
TCCGGCTCTGCGTTTTCTACTCATGATATGGGTCTGAGCA
TCTTTAAGGGCACCAAAAGATTTGTATCTTCATATGAGTA
TAACTCTAGCGATCGCAACGATCAAATGTCCAACGGAGCA
GTGCTGGAGCTGGATGTCGGAGAGCAGGTTTACATGAACC
TGTGGATCAGATCATGGATCTTTGTGGATCGACGGTACAA
CTACTCCACTTTCACAGGATACCTGCTTTACCCACTGGAA
ACTGCTTGATCTGTGAATTGCTTTGTAAAATATCAAAACA
AACTGTTGAAGTCGATATTAAATGTGCATTCTGGGTTGTT
ATACAAAAGAAAAAAAAGTTTTATTAAACGGCCAGATTAA
TTTGAATGATAACGAGCCACCTTGTTAATAAACTTATCAA
AATATTTCAAAAAGCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cbln11-201 Contained in:
[BAC] CH211-63P21 (1)

Genome Resources: Vega_Trans:OTTDART00000062999 (1),  Ensembl_Trans:ENSDART00000128855 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)