ZFIN ID: ZDB-TSCRIPT-160112-871
Transcript Name: si:dkey-28d5.14-204
Previous Name: si:ch211-63p21.5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062996 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062996|OTTDARG00000043415| CH211-63P21.5|OTTDARP00000049255 CH211-63P21.5-002 LG_ CT027762.14 Danio rerio protein_coding NOVEL, 1095 bp
ACACAGTCTGAAGCTGCAGCCAGAAACATCAGACTGAGGA
CAGAAACACACCAACTCTGAGGAATGGCTCAAACTCTATA
TTTCCCTCTTCTCCTCATTGCTCTCTGCTCCATATCTGAA
TGTGTTCAGCGTCAGTATCACTTTATAAATGAGCTGAAGA
CCCGGACTGTAGCTCAGCAATACTGCAGAGAGAAATACAC
AGATCTGGCCACTGTTGACAACATGAACGACGTGAACCAG
CTGATTAAATTTGTGAAAGTGAATGACAGAGGGGTCTGGA
TTGGTCTTCAGGGTACGAATGATATTAAATGGCATTGGTC
TTCAGGTGGTCCTGTGCTCTTTCTGAACTGGGCATCTGGA
CAACCATACAGCAGAAATAATTGTACTTTTACAAAGAATG
GACAGTGGTATGTTGGGGCATGTAATGCCACCTGGACTTT
CATCTGCTACAACATGAGCACAGGACTGGTGTTTGTCAAT
CAGATGAAGAACTGGAGAGACGCTCAGAGTTACTGCAGAC
AGAATTACATTGATCTGGTCAGTGTGAGGAACCAGAATGA
GAATCAACAGCTGGAGAAGTTCATTAATGACAATCAGATA
TCTGGATCTGCAGTCTGGATCGGTCTGTTTAGAGACCCAT
GGCAGTGGTCAGATCAGAGCAACTCCTCATTCAGATACTG
GAAACCTGATAAACTGATTGTGATCCAGCAGAAGCTATCA
TGGTCTGAAGCTCTGAGATACTGCAGACAGAATCATGTGG
ATCTGGTCTCAGTTCAGTCAGAGGAGATGCAGAATGAGGT
GATGAACGTGGTTAAACTGGCGTCTACCGAGGCGGTGTGG
TTGGGTTTACACAACTACTGCAGCATGAACATGTGGCTCT
GGGTGAGTGGAGACATGGTGTGCTATCAGAACTGGGCTCC
AGGGAACGGCAGCACACCGGAAAACTGCGAACTGGAGAAC
AGAAAAGGAGCAGTTCAGTCTGGAGGAGATCAGACCTGGA
TCAGCCGTCCTGAATCTCACAGACTCAACTTCATCTGCAC
TAACTACTGAGACAAAAGATGTGAGATTGTTGGTGTTTAC
TTCCATTCACTGTTT

si:ch211-63p21.5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-28d5.14-203 (1)    Ensembl 1212
si:dkey-28d5.14-204 1095
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-28d5.14-204 Contained in:
[BAC] CH211-63P21 (1)

Genome Resources: Vega_Trans:OTTDART00000062996 (1),  Ensembl_Trans:ENSDART00000172752 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133850 (1) 1573 nt
CITATIONS (2)