Transcript

si:dkey-28d5.14-204

ID
ZDB-TSCRIPT-160112-871
Name
si:dkey-28d5.14-204
Previous Names
  • si:ch211-63p21.5-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062996 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062996|OTTDARG00000043415| CH211-63P21.5|OTTDARP00000049255 CH211-63P21.5-002 LG_ CT027762.14 Danio rerio protein_coding NOVEL, 1095 bp
ACACAGTCTGAAGCTGCAGCCAGAAACATCAGACTGAGGA
CAGAAACACACCAACTCTGAGGAATGGCTCAAACTCTATA
TTTCCCTCTTCTCCTCATTGCTCTCTGCTCCATATCTGAA
TGTGTTCAGCGTCAGTATCACTTTATAAATGAGCTGAAGA
CCCGGACTGTAGCTCAGCAATACTGCAGAGAGAAATACAC
AGATCTGGCCACTGTTGACAACATGAACGACGTGAACCAG
CTGATTAAATTTGTGAAAGTGAATGACAGAGGGGTCTGGA
TTGGTCTTCAGGGTACGAATGATATTAAATGGCATTGGTC
TTCAGGTGGTCCTGTGCTCTTTCTGAACTGGGCATCTGGA
CAACCATACAGCAGAAATAATTGTACTTTTACAAAGAATG
GACAGTGGTATGTTGGGGCATGTAATGCCACCTGGACTTT
CATCTGCTACAACATGAGCACAGGACTGGTGTTTGTCAAT
CAGATGAAGAACTGGAGAGACGCTCAGAGTTACTGCAGAC
AGAATTACATTGATCTGGTCAGTGTGAGGAACCAGAATGA
GAATCAACAGCTGGAGAAGTTCATTAATGACAATCAGATA
TCTGGATCTGCAGTCTGGATCGGTCTGTTTAGAGACCCAT
GGCAGTGGTCAGATCAGAGCAACTCCTCATTCAGATACTG
GAAACCTGATAAACTGATTGTGATCCAGCAGAAGCTATCA
TGGTCTGAAGCTCTGAGATACTGCAGACAGAATCATGTGG
ATCTGGTCTCAGTTCAGTCAGAGGAGATGCAGAATGAGGT
GATGAACGTGGTTAAACTGGCGTCTACCGAGGCGGTGTGG
TTGGGTTTACACAACTACTGCAGCATGAACATGTGGCTCT
GGGTGAGTGGAGACATGGTGTGCTATCAGAACTGGGCTCC
AGGGAACGGCAGCACACCGGAAAACTGCGAACTGGAGAAC
AGAAAAGGAGCAGTTCAGTCTGGAGGAGATCAGACCTGGA
TCAGCCGTCCTGAATCTCACAGACTCAACTTCATCTGCAC
TAACTACTGAGACAAAAGATGTGAGATTGTTGGTGTTTAC
TTCCATTCACTGTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations