Transcript

znf740a-201

ID
ZDB-TSCRIPT-160112-747
Name
znf740a-201
Previous Names
  • znf740a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062610 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062610|OTTDARG00000043232| znf740a|OTTDARP00000048951 znf740a-001 LG_1 CABZ01055593.1,CABZ01055594.1,CABZ01055595.1,CABZ01055596.1 Danio rerio protein_coding KNOWN, 3416 bp
GGCGTTTCCTGTGTTTGTAAACTGACCTGAGCCGAAATAA
AAGCGAATTTGAACACTACCAAGAAAAGCCATCGCCGCCT
CATGATAGAGTCCGGTGAGATCTGTGTGACACTGGCTCTG
AACTGACATCTGCACATCTCTTCTGTCTGAACTGCTGTCC
GTCACCATGTCACATATACCCGGCAGCTCGGTCCGGGACC
ACATGAAATGGGCAGGGCTGTTGGGATGTGAAGCCGTATT
GTCCAGCATGGCACTGATGCAGGCCAGCTCCATCGCTGCT
CCCAAGAAGATGATGTCTCCGCTGGGTCCGGCATCTGCTC
ACGGGTCTGGCCAGAGGGATATGCAGGAACGTGGGACACA
AGGACACATGGTCTTACCCACCAGCATGACCTGTCCTCCA
CTGCTTCTGCGGAAGGAGGCTGATTTTACAGCTCCCCGAC
TGCTGGATGAGAAGGAAATGAGACCCAGTGAAGACATGCA
GCTGAAAAAAAAGACCAGGAAGTCGGGAACACCCTCAAAA
GTACGGGAGCAGGACGGCCCGGCGGGGAAGGCCGTTGTGG
ATGAAAATGGAAACTGTCCACTTTCTAAAGTGCAGAAGAA
CTTTATCTGTGATCACTGTTACGGGGCCTTCAGAAGCGGA
TACCACCTGAAGAGACACATCCTCATTCACACTGGAGAAA
AGCCATTTGCTTGTGCAGTTTGTGACATGAGATTCATTCA
GCGTTATCATCTGGAGCGACACAGCCTCACTCACACTGGG
GTGAAGCCGTACGCTTGCTCGATGTGTGACATGAGGTTTT
TTCAGCGTTACCACCTGCAGAGACACAGCCTCACTCATAC
GGGGGTGAAGCCGTATGCTTGTTCCATGTGCGACATGAGG
TTTTTCCAACGTTACCACTTGGAAAGACACAGCCTCACTC
ACACTGGAGAGAAGCCGTTTGCGTGTGACATGTGTGACAT
GCGCTTCATTCAGAGGTATCATCTGGAGCGACACAAGCGC
GTTCACAGCGGAGAAAAGCCTTACCAGTGTGAGCGCTGCC
AACAGAATTTCTCACGCACAGACAGACTGTTGAGACACCG
GCGGTTGTGTCAGGGTCGTGGCGTGACGAAAGTCGAAGCG
CAGCCGTGCCCTTACACACAGGAGCCTCCGCCGGCCCCCA
CGCCCACATGGAGCCCCCTGCATCCGGCCCCAGGACGACT
GGCCGTGTGACATGCCCTAAGAAGACAACACACCTCTGAA
CACCACCACTGCCGAGTGCAGACCGCTTCCCTCCTCAGAA
ACACACACGGTTTGACCACCCAGGCTTCTTTTGTACTTTT
TGGTAACACAATTAGAGGGTTTTATGGTACTTTAAAAAGA
GACGAGGAACAAAAACACACACACACACACATGGCTGATG
TGGGAAATATGTTACTAACCAAAAAACAAAAGTGGTACAA
CCTGTCATATATAAACTGATATTCATACACTATGTAATAG
ACTGTTTATAACACTGAAGCACACAAAGAAACACACACAC
TCATCACACATCCACAGGACAACATTTGATCTGATATTGT
AAGTGTGTGAAATTGAAAGATGTGTATATTAATGTGTGTA
ACAGCTGGTTTGTTCTGTCTTTGTCATACAAATCTGACTA
GAAACCATGTTTGATCGTCAACTCGCTCAATCAGAAATTA
TAATTTGCATTAAGAAAATGAAGCCTATTTTAGGACCAGA
TTGTTTTTTTATTATTTAGCATATTTTAGGGTTGTCACGA
TACTAGAATTCGGTATCAATCGATGCTGAAATTTTAAAGA
CGTCCCTTTCCCGTTAACATTTGAGCGCTGTTGAGCGATT
TCATAAGCAGTGCTGATTGACCATTGTGTTCACGTGCTCA
ACAGAAATGACTGTGATTGGTCCTGAAGGTCATCAGTTCA
CCAAATTCACCGCTGTTTACTGAGTGTAACCACAGAGACA
GGGACACTCGAGCATTTTAAAGCTGCGGTTCATCAGCGGA
TCGCTCACATGCCAGCTTATAGACAAACCAGCTGATCGAC
GTGACTTTGTTTACACTCGGTAAACAGTGGTGAGTTCGGT
GAACTGATGACCTTCAAGGCCAATCACAGTCATTTCTGTT
GAGCACGTGAACACAATAGCAAATCAGCGCTGTTTTAGAA
CGCGTTCAGATGTTAGTGGGAAATGGACGTCTTTAAAATT
ACAGTACCAATTGGTACCAAATTCTAATAACGTGACAACA
CTAGAATATTTGATTGATATTATAAAGAAGAATATGCATT
TTGGTCTCAAATATGGATAATTATATAAATGCATAAGCAC
TGAAGGCTTTTAAAGTTTGCTCTACTGACTTTTGGAAATT
ACTAGTAATTAATAAACAGGAAAAACACTACAAATTATGA
ATTAAATTTAAGTTTAAAATGCTTTAATGAGCAAGACCTT
CAGTACAGTAATTATTGTTTTATGTTAATAAATCAAACAT
AACTGACTACTTTTATTTTCATAAGGTATTAAACAAGACT
AATAAATAGCTTTTTACATAGTTTTGCTTGTTAATAATCT
AAATGTAATACTAAAAATTAAATGGTCCCAAAAATAGGCA
TTTTCTATGTGCTAATATATTAATTTTTTCTGATTTTGGA
TGATATTATGGGCAAAAATGTGCGACTAATTTTGACTACA
TTAATGAAAACGTCCAAAAGACCCACATTATGTTATGTAC
AGATTTATATGTGCGACATTATTCCATCTTGTGGCCTTAG
GATGTGCTCATGTGTATTCTATACTATTTTGGTTTGGATT
TTTTTTACTCCTTTGTTATGAAAAGATGATATACTTTTTA
TTTGACTGAATCGCCACAGGTCAGAAAGGCTGCCTTTTTA
GTTTTGTTTCTTTCCAAAGTCATGTAAAGGTCGTATTGCA
TCGTGAAGGAGCTCAGCCGTGTTGCTTCTCTGTGGATGTA
GTGTTTTCCGCTGTAATCTCTGCGATGGAGGAGTTCGAGC
AGTGTTTTATTTTATTTTACTTTATGCAATGCCTTCACGA
GCGGTCGACCTCAAACAGAGCAAAAAACGCTGATGTTTCT
GTTGCGCCACATGATATCAGCTTTTTAACGTGTCATATTA
TCTGCTGTTGGACGAGGCTCTCGGCTGAATGGACTGAATT
GGGCATTTCTGATGGAAACGGAGGGACGTCTGCTGTTTAT
TGACTGAAGATTGCTGCATTTTTATGTAATGACTGAATAT
TTTTCTTTTTATCGTTACACGTATGTTTATATATTACTGA
ACTGGTTAAACCTCTTAGTTCTATAGCAACAAACTTTGTG
TATTTTGAGGACCTTTTTACTCTAATATAATTTTAAAACA
CTGGAGAGATACATGTGTGAAATGATAATCTATAAATGGA
CATATACAGTTCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations