ZFIN ID: ZDB-TSCRIPT-160112-703
Transcript Name: ankrd13c-201
Previous Name: ankrd13c-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062472 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062472|OTTDARG00000043147| ankrd13c|OTTDARP00000048832 ankrd13c-001 LG_none CU459093.10,FQ323135.7 Danio rerio protein_coding KNOWN, 2855 bp
CGTTTGTTTACCGTTCGATGCGTCGCTCCGGTGCGTGTCT
CATTCCCGTCCGTCTCCGTTGAGTCACCGGACAGTGTTCA
TGTTGTGCGGGCTGCCGTTCTCCGCCGCTCATCTGTGTAA
ATATGACGGGAGAGAAGATCCGCTCGGTGCGCAAAGAGCG
CAAGTCGGGTTTGGATCTACTGGAGCCGGACGAGGAGCCC
GCGGCCACCGGGCCCGCCAAACACCGGGGCAGCAAGATCT
TCAGCGGCGGGAACCACAGGATCAGCCGCTCCAGCTCCAG
CCCCGGGGACCCTGACGGAGCCTATCCCGTGCATGAGTGC
GTGTTCCGGGGCGACGTGAGGCGGCTGTCATCGCTCATCC
GCACGCAGAACATCGCGCAGAAGGACGTGCACGGAAACAC
TCCTCTTCATCTGGCCGTCATGATGGGTCACAAAGAATGT
GCTCATCTCCTGCTGGCCCATAATGCACCAGTGAAGGTGA
AAAACGCTCAGGGATGGAGTCCGCTCGCGGAGGCCATCAG
CTACGGAGACCGGCAGATGATCACAGCTCTGCTGCGCAAA
CTGAAACAGCAGTCCAGAGAGAGTGTGGAGGACAAGAGAC
CCCGACTGCTGAAAGCACTCAAAGAGCTTGGAGATTTCTA
TCTAGAGCTGCACTGGGACTTCCAGAGCTGGGTGCCTTTA
CTCTCCCGGATTCTACCGTCTGACGCCTGCAAGATCTACA
AGCAGGGGATCAACATCCGTCTGGACACTACACTGATAGA
CTTCACTGATATGAAGTGTCAGCGTGGAGATCTGAGCTTC
ATCTTCTGTGGAGACGCTCCTCCGTCAGAGTCCTTCGTGG
TGCTGGACAATGAGCAGAAGGTGTATCAGCGCATACATCA
CGAGGAGTCAGAGATGGAGACGGAGGAGGAGGTGGATATC
CTGATGAGCAGTGATGTGTACTCCGCCACTCTCTCCACTA
AATCCATCACCTTCTCGCGCGCTCAGACCGGCTGGCTCTT
CAGAGAGGACAAAACGGAGCGCGTGGGGAATTTCCTGGCT
GATTTCTACATGGTGAACGGGCTGGTTCTGGAGTCGCGGA
AGAGACGGGAACACCTGAGCGAGGAGGACATCCTGAGGAA
CAAGGCCATCATGGAGAGCTTCAGCAAAGGAGGAAGCCTC
ATCGAGCAGAACTTCGAGCCGATGAGGCGGCAGTCTCTGA
CCCCTCCATCACCCAACACTATCTCCTGGGAGGAGTACAT
CACTGCTGAGACCGGGAAAGCTCCTCATCTGGGTCGAGAG
CTGGTGTGTAAAGAGAGCAAGAAGAACTTTAAAGCCACAG
TAGCCATGAGCCAAGACTTCCCTCTGGGCATCGAGTCGTT
GTTGAATGTGCTGGAGGTCATCGCACCCTTCAAGCACTTT
AATAAGCTCAGAGAATTCGTTCAGATGAAACTCCCGCCTG
GATTTCCTGTCAAACTGGACATCCCGGTTTTCCCCACCAT
CACTGCCACCGTGACCTTTCAGGAGTTCCGTTACGATGAA
TTCGACGAAAGCATTTTTACGATTCCCAGCGACTACAAAG
AGGATCCCAGCCGCTTCCCAGACCTCTGAGCTGCTTCACG
TCCCACCTTACCCCGCTGTCCCGTCTCCATCTCGCCTCCA
TCCCTCCGGTGACCAGCAGATGGAGCCCGGCGCGTTTCAC
GTAGAAAATACTTGATGTAATATGGACATAAAGGGATTGC
GTTGAAAACGGCGCGTAGGGAAGGGAAGGCCACTGCTGTC
CGAATATACGGGACTCTCCTGCACTACATGATCAAGCTCT
GTTCTGAGTTCTGCGCGAGAAATCTCCGATTGTGTGTCGG
AGCTCAGGACAGTGCGGTACGTTAGAAACACGGCGGCTAG
TCACTTCACGTCACCTGGCAGGAAAATATGGCATTATAAA
TTATTACATAAGCCGCGTTTTCATATATATCTTTGTACAA
CTGTTACAAACTTGTATACTTCACTTAAAAGCAAAGTGTA
TATTTAGGAACGAAGCGGAAGGCGTCTGTATATGATTTGA
AATCTGTCGCAGAATACTATGTAAATGTCATTTCTACGAG
TTTCTTTGCGCAACTTGTAAATATATAACCTGCTCTGGTT
CCTGTTTTTGTTGCATTATGGGCTCACTTTCTCCTTCACT
GCATTTCCGGTGCTTTAGTTCACCTGCTTTACTTTTCCTC
ACGTCCTAATAACTAGCTGACGATCTTACAGGGCCAGATG
TCGATGTAGCAGAACATGTTTTCGCCTGTAGATTTGGTTT
GGCTTTATGATAGATGGATGTAAATACATGCAAACTGAAA
CATGTTTTCTCCAGTGTAGTATAATTGACATGTATAACTG
ACGAGTATGTTTATTGAGATATTAGTGTCAAATGTTTCCG
GAGACGTTGGGTAAAAGCCCTCAAGATACGGCGACGGCTT
ATTTCATGAGTGTTTGATCTGTTTTTGCTGTGTGCCGAGG
GAAAAGGAGTTAGCGTCACGTTTGCACCAGCAATATCCCG
TTGGAAAAGTACAGTTCCTCTTTTATGTCTCTTGTGTTTT
GGTTTTTCCTCTTCCGAATGGAAACGAGCTGCAACTCTTC
CATCACCCACTACTGGCTAGTGTGGAGAACTCCTGTGTTT
TGCTGTGTTTTTTATTTTATTTTTTATTATTATTGTTTTT
TGTTACCAGCTTCTTTTCCTGTGTTTGATGTTACTGTTTT
TAGCTTTATGACTTCAGTACCCTTCAGACTTTCTCCCAGA
CGCATTGAACTCCCTGACGTACAGCGGGAACCTTGTATGA
ACCTGCTGCACTTTTACATGACAAATTGTAATTAATAAAA
TGTCCACGTATCACG

ankrd13c TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ankrd13c-002 (1) 1977
mRNA ankrd13c-201 2855
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankrd13c-201 Contained in:
OTHER ankrd13c-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062472 (1)
  • Ensembl_Trans:ENSDART00000163185 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC047821 (1) 2875bp
    GenBank:EG582544 (1) 910bp
    GenBank:CA496394 (1) 836bp
    GenBank:EB951462 (1) 650bp
    GenBank:BM102270 (1) 484bp
    CITATIONS (2)