Transcript

si:dkey-83f18.8-201

ID
ZDB-TSCRIPT-160112-560
Name
si:dkey-83f18.8-201
Previous Names
  • si:dkey-28d5.15-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063014 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000063014|OTTDARG00000043420| DKEY-28D5.15|OTTDARP00000049266 DKEY-28D5.15-001 LG_ CR318599.18 Danio rerio protein_coding NOVEL, 1087 bp
AAATGGCCCAGAAACTACAGTTCTTTCTTCTCCTCATTGC
TCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATCAC
TTTATTAATGAGATGAAGACCTGGACTGAAGCTCAGAGAT
ACTGCAGAGAGAAATACACAGATCTGGCCACTGTTGACAG
CATGAATGACACAACTGAGCTAATGAAAATTGTAAATAAT
GTACGTCTCTGGATTGGTCTTGAGAGGAAATGGCAGTGGT
CTTCAGGTGATCCTGTGCTCTTTTTGAATTGGGGAGATAA
ACAACCTGACGGCAAAGATGAGTGTGCTTTTATGAGAAAT
GGAGAGTGGCATGATTGGCCATGCAACAAAGACTGTTTTT
TTGTCTGCTACAACAGGAGCAGAGGACTGGTGTTTGTTAA
TGAGAGGAAGAACTGGACAGATGCTCAGAGTCACTGCAGA
CTGCATTACACCGATCTGGTCAGTGTGAGGAACCAGAATG
AGAATCAACAGCTGGAGAAGTTCATTAATGACAGTCCGAA
ACCTGAACCAGGATCTGATGTCTGGATCGGTCTGTTCAGA
GACTCGTGGCAGTGGTCAGATCAGAGCAACTACTCATTCA
GTAATTGGAAACTTGGTGAACCAAATAATGTTGGAGATCA
TGAAAACTGTACAGCAGTTGAAAAGGATGCCCAGGGACAA
TGGATAGACATTTCTTGTGACCACCAGCTTCCTTTTGTGT
GTCATGAAGATAAACTGATTGTGATCCAGCAGAATCTGTC
GTGGTCTGAAGCTCTGAGATACTGCAGACAGAATCATGTG
GATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGTATGAGG
TGATGAGCGATGTTAAAAAGGCGTCTACTGAGGCGGTGTG
GTTGGGTTTGCGTTTCTCCCACATTTTGGGCATCTGGTTC
TGGGTGAGTGGAGAAACCGTGTGCTATCAGAACTGGGCTC
CAGGGAACGGCACATCAGAGGAGAACTGTGAGGCCACAGT
GAGATCTGGAGCAGTTCAGTCTGGAGGAGATCAGACCTGG
ATCAGCCGTCCTGAAACTCACAAACTCAACTTCATCTGCA
GCAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations