ZFIN ID: ZDB-TSCRIPT-160112-555
Transcript Name: klhl33-201
Previous Name: klhl33-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062998 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062998|OTTDARG00000043416| klhl33|OTTDARP00000049257 klhl33-001 LG_ CT027762.14 Danio rerio protein_coding KNOWN, 5535 bp
CGAGATGTGATGTTACAGAATGCTGGAGGTAAAAATAGCG
CTATGTTTGGTCTGAGCTCATGATACACTGCTCTTTTCTC
ACACACCTGACTACAGTACCAGGTCCCACATCAGTTGAGA
TGGAGCTTTTTCTTGGGCTTTGAACAGAAGTGAGGATCTA
GTTGGTATTTGGACGGAAATCGAGAATTCTGCACAATGGC
AATAAATCAGCAGTGTCTGCAGAGCGAGTGGAGAAGTTCA
TGGAGATCTGCGAGAGAGGATGAAAGTGTAAATGGTGAAA
ATGAATGGATAGATCAGGAGAAGCAAGAAGAGGAATATGA
GCAGGAGATAGACACAGAGATGCAAGTTGAATGGGAACGT
AAGAAAGCTGAAGATGGTGAAGGGTGTAGTATTGCTTTTT
CTGCAAACAGCAACCATGTAGATGTGATGTGTGCAAATGA
CAACAGCAATAACGTTGATGTATGCAGGGATCCTCTGCCT
GTTGCTAACAGTGATGCATTTGCAAGGTACGGCAGTGGTA
AAGTTGACGAATCTCAAGATGATGAAGAAGAAGAATCTAC
TTTGAGCTTTCATGACACATCTGGAAAGAGTGAAGGTTTG
ATGTCTGCTTGCAAAATTAACGGAAAGGCATATGATGTTG
ATGAGGAACTTAGTGTTAGGTTTCCTGCTACATCAGCTGA
CGGTTTAAAGGCTGCAATAAAAAATGATGATGGAGATGAG
ATTTTACCTGCAACTTCTGCAACCAGTGATGATTTGGTTT
GTAAATATGTTGACATCAACAGCAATGAAGAACATACTAG
AAGTGTACCTACTACTTCTGGAAGTGGTGACCACTTACTT
GCTGTGTGTTCTCATAAAAGTAAAGGACCTGTTAAGGAGT
TTGATAAATTTGAAAATGATGAAGATGACCGCTTTGCTTC
TGCTTCCACGAGTACTTGTGAGACTGGAAGATCTGAAAAA
AACGTAACATCTCAAGACGAAGAGCAACAGACTAAACAGA
ATCAAGCGTCTGATGATAATGAATATGGTGGACTTTACAG
TTTTGAAGATTTTGATGACGAGGATGTCGATGTTTATCCT
AAGAAGCTGTACTCTGATCCTGCATTTGCAAGTGTGGTCT
TCCAGACTCTGGAGAACATGATGCTGAATCTGGTCCTCAC
TGATTTGACTCTTTGCACAGAAAATGGACATCAATTCCAG
GTTCATTCAATTGTCCTGTCGGCGGTCAGTTTATATGTTC
AAGCAAAGCTCAGATTGAAGCCCAGACAAGAGAGGAATAC
TGTATTGTGCTTGGGTCCTGAAGTTCAGAGTTCGGGGTTG
GCAGCGGTAGTAGAGTTTGCATACACTGGAAAGATCTCCA
ATCTGAACAAAGATAATTTTGAGTCTGTGTACTCTGCTGC
CATCAGCCTGGAAGCTCTGGATGTTCTGGAACTCTGCCGA
GAGGAGAAACGGATAGAAGATGACAAGACAGGAGGGAAGA
ATGAAGAAAGAAAAAGGTTTTCAGCTGAGGAACATCTGAA
TGTTTGTTTAGGGCATATTGGACAGCTGTGGGCACAGAGA
CTGGGATGTGATGTGGAGCTCGAAGCAGAGGGACGAGTGT
TTCATGCTCACCGGGTGATCTTGGCTGCCAGCAGTGACTA
CTTCAGAGGCATGTTTACCAGCGGCATGAAGGAGAGCCGG
CAGGAATTGGTTTCTCTGTTGTTGATCAGGGCTTGCAAGT
TTGAGGTCCTCTTGCATTACTGCTACAGTGGGGCTCTTGC
TCTTGGATGGGGTTGTGTGTTTGATCTGGCCTGTACATCG
CTCCAATTACAGTTTCAGACTGCCTTCTCACTATGCACTA
AATTTCTGCATCAAGAAACCGATGCTCACAACTGCCTGGA
TGTTGTGTCTTTCGCAGAGGCCTACGGAATGCCTGAATTA
CATGCATTTGCCAATGACTTTGTCTTAAGGCACTTTCAAG
ATGTGTCTATCACTCCAAAATTCCAAGACCTTCCTGTAGA
GAAACTTAAGAAATACCTTCAAAGTGATTCTCTATGTGTT
CCCTCTGAGTTATCCGTGTTCAAGGCAGTCCTGGCCTGGA
TTGAAGCCTTTCCAAGACAAAGAGTGAAACTTGCCAAAGA
GCTGATGGGAACCATCCAGTTCCATCTCATGACCTATAAG
GAGTTCAAAGAAGTGAAATACATAACATCCTGGCCTAGGA
TTGGTGCCAAACATCTCTACAATTCTCTACTTGAGGAGTT
CTGCTTTGGTTCTCCAGCTGCCCAGTCAAATTTCAGGGCC
TACATGCCTAAACACAGTCTAGTCCTTGTTGGTGGTGAAA
GAATCACTGATAATCTTGACAAACGACTTCCCTGCAGGGA
AATGTGGTTTAGCAATTCCTTGCAGAACCATGTGGGATTG
GTGAAGAAAGTAGAGTGGAGAACGTTGGGAACTTTACCTG
ATAAACCAAGATTCAATCACGGAGTTTGTGCAGTGATGGG
GAAGCTCTACATAGTTGGAGGGCGGTATTATTACGGCAAA
GACGATACTATGAAATGCACCTACAGATATGATCCAATGC
AAAACACTTGGCAAAGGTTGGCTGATATGAACGAGAAAAG
AGGAAACTTTGCTCTTGTGGTCCTAAATGATCAAATATAT
GCAATTGGTGGAGAGAGAGACTCTGAGGTCAACATGGAGA
GTGTAGAAGTCTACTGCCCCAACAAAAACTCTTGGAGATT
TGTCCATCCACTGGAGCAAACTCTATGTTGTCATGCATCT
ACAGTATGGAATGGCAAAATCTTTATATCAGGAGGCCTCG
ACAGCCAGTACCACTGTCTGTCATCTATGATCCTGTACAG
CCCTGAGTCCAGATCCTCTTACCTAGCTGAAATGAGTAAG
GACAGAGCCCTGCACTGCATGGAAACCCTAGGTGACCGTC
TGTACGTGGCTGGAGGAGTGTCAAGCAATGCACAAGGCAG
TCTGGAAGATCAGTTAGCCTGTGAGGTCTATGATCCTGTG
GCCAACTCCTGGAGTGCGATTATGTCGTTCTCAGTGCCTC
ATGTTGGGTCAGCATCAGCAGTCTTAGAGGGGAAGATCTA
CGTAATCGGAGGGTATTCCCATAAGGACTACAGTGACACC
AGATCAGTGCATCGCTATGATCCTACTACAGAATGCTGGG
AGAACTTGAGCCAGACACCAGGCCCAAACACATGTGTAGC
TGCCTGCGTGCTGCCCATACCTGCTCACCTTAGAAAGTGA
GAGAGGAAAATCCTGAATGCATGGCATAGTTAATGCACAG
AGTATATTCTAGCATCATTTACTCACCTTCCACTGGTTTC
AAACTGTCTTTGGGTTTTTTAATATTTGGAAGAACTCTGA
AAACCAATAACCATCAACTTCCATAGTATTTTAACAATGG
TTACAGGTTTCCATTCATTCATTTGTTTTCTTTCGGCTTA
GTCCCTGATTATCAGGGAATCACCTACAGCAGGGGTGCCC
AAACTCGGTCCTGGAGGGCCGGTGTCCTAGGGATTTAAGC
TCCAACGCTAATAAAACACACCTGATCAAGGTAATCAAGC
TCTAACTAGCTTACTAGAAACTTCCAGGCAGATGTGTTAA
AGCAAGTTGGAGCTGAACTCTGCAGGACACCAGCCCTCCA
GGACCAAGTTTGGACACCTCTGACCTACAGGTTTCCAACA
TTTCTCAATATCTTATTTTGTATTCAAGAGATTAAAAGAA
TCCCCAAAAGGTTGAAAACCACTTGAGAGTGTAAATTGTG
CGTAAATTTTCAGTTTTGGGTGAATTATATCTTTAAGCGA
AAGATATGGCAGACATCTTTCTGGCACATACCGTAGGACA
TATGCATAGTGGATCGGCCTTTGAGATAGACAAATAGAGA
TAAATGCTGCACATATATCCAACATTTATTTTATTGAACC
TCTTTTGGTGTGTTATGGAAAAACATCCACACATTGCCAT
ATTAAAGCTTGAAAGAGTCAGGATAATCTCTTTAGAGGTA
TCATACAGTACATTGAGTCAAATTGTTCTTCAATATGTAA
ACCATTAACTTTACCTGCTCAAAAAAGACATAATGTTTGA
ATGTATCAAACAAATCTCAAGTACAGGGACAGAAGACAAC
AACTTAGAGCAAATACACAAAAGTAAATAATAACAAGCTT
GATTTTTGAGCGCTATCAAGTTCATAAACACCGACAATTG
GCCATTGTGTTCACATGTGTAACAGGATAGGCTGTGATTG
GCTTTAATGCCCAGCGCTGTTCACTTGTCAGTGACGCAGA
GAACAGACCTGCGTTCTTGTGGAGACCGGTCTTGCCAGGT
GTCTTCGGAAGAACAAACTCAGGACACCGCGAAGGCAGAG
AACGCGTCCTTTGAGAAATGAGATGCCGCGTTCTTCCTGA
TGGTCATGTGACCTTCACGCGTTTTAAATGGTAAATTATT
TAAACGGTGCAGCATTCATACAACGATTCATTGCTTTCCC
CTTTTCAAAATATATACTTTGCATAAAAAACAATATAAAT
ATACTCTGCACAATATAAATAAAACAGATTTTAATACGAA
TTTCAGCAAACAAACACCCTTAATGTGTTTATTCCTTTAT
TAAGATGTTCATGGTGATGTTTACTTTCACCGTTTCATTT
AGGGAAACTCCTGAGGTAAATAAGTGATGTCTCTGAACTT
TAATAATAAATCTAAATAAAATGCTGCGCTTCCCACCTCC
AGTCGCAATGACTTCTGGGACTTCCAAAGCGAGTTCGGTG
TTCAAGTCTGCATCGGTGCATCCTCGATATCAAGATCACA
TCCGGGAAGTTTCACGCGTCCTCTGTACTTGTGGTCTTGA
GTATTGGAACTGACCCTATGGAGCTGATGATTACGTTGCA
TGAGAACACGAGGACGCAAGACTGCTAAAGAATGGATATT
GAGAAACAGTCATAGGCACTGAAAAAAGCTGCGTCTATCA
GCTGATCCATTAGCGGCTGATAATAGACACACTCTGTGAT
AGATGCAGTTGAGAAAACCTGCTCTGCGGATACTCTTGTA
CATAAAGACAGAAGTATCACTGTAACCAATGCTATTTCAC
TGCAATCAAAAACGTTTTGATTTAGCTAATTCGTATAAAA
TTTGTACGATCTCATTCTTGCATTTTAGTAGGATTTGCTC
ATCCCCCAATGATGCTTACTTTTAAAAACTTTACATTTTA
GTATGACTGAATGAATTTGAATTCGCAACTAATCTAACAA
AATGTCAAGTAAATGATTCCTCATGAGATCAGGCTGGTGT
AACATATGAGAGAGAAGAGGATAATGTTACCTCACGGACA
CGCTAGCAGGTCGAAGAGTCCACAGTGAGAGAGATGCAGT
GGAGCTTTACAGCTTTCGAAAAAAAAGAAAGAAAAATCAA
TACATTCGCATCAAGTATCTGTTTCGATATTTTGTTAATG
GCCTCATTTGTTACGTTTTCTGAAGTTTTATGTAAGATTT
TATACTTGTTTTGTTGCTTGCTTATTGAACGTAAATAAAG
TAATATCATACCCAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
klhl33-201 Contained in:
[BAC] CH211-63P21 (1)

Genome Resources: Vega_Trans:OTTDART00000062998 (1),  Ensembl_Trans:ENSDART00000173260 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)