ZFIN ID: ZDB-TSCRIPT-160112-554
Transcript Name: si:ch211-63p21.4-202
Previous Name: si:ch211-63p21.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062995 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062995|OTTDARG00000043414| CH211-63P21.4|OTTDARP00000049254 CH211-63P21.4-002 LG_ CT027762.14 Danio rerio protein_coding NOVEL, 1081 bp
AGTCTGAAGCTGCAGACAGAAACATCAGACTGAGGACAGA
AACACACCAGCTCTGAGAAATGGCTCAGACTCTATATTTC
CCTCTTCTCCTCATTGCTCTCTGCTCCATATCTGAATGTG
TTCAGCGTCAGTATCACTTTATAAATGAGAAGATGGACTG
GACTGAAGCTCAGAGATACTGCAGAGAGAATTACACAGAT
CTGGCCACTGTTGATAACATGAACGACATGATCCAGCTGA
ACAAGAGTGTGAAAGTGAATGACAGAGGGGTCTGGATTGG
TCTTCAGGGTACATATGACAGTAATTGGCATTGGTCTTCA
GGTGATTCTGTGCTGTTTCTGAACTGGGCATCTGGACAAC
CATACAGCGGTGATAATTGTGCTGTTATGATTAATGGAAA
GTGGTTTGTTGGATCATGTAGTGTTACCTGGACTTTCATC
TGCTACAACATCAGCGGAGGACTGGTGTTTATCAATCAGA
CGATGAAGTGGACAGATGCTCAGAGTTACTGCAGACAGAA
TCACATTGATCTGGTCAGTGTGAGGAACCAGAATGAGAAT
CAACAGCTGGAGAAGTTCATTAATGACAGTCAGACATTTG
GATCTGCAGTCTGGATCGGTCTGTTCAGAGACATTTGGCA
GTGGTCAGATCAGAGCAACTCCTCATTCAGATACTGGATA
ACTGATAAACTGATTGTGATCCAGCAGAATCTGTCGTGGT
CTGAAGCTCTGAGATACTGCAGACAGAATCATGTGGATCT
GGTCTCGGTTCAGTCAGTGGAGATGCAGCGTCGTGTGATG
AACGTGGTTAAACTGGCGTCTACTGAGGCGGTGTGGTTGG
GTTTACACAACTACTGCAGCATGAACATGTGGCTCTGGCT
GACTGGAGACATGGTGTGCTATCAGAACTGGGCTCCAGGG
AACGGCAGCACACCGGAAAACTGCAAACTGGAGAACAGAA
AAGGAGCAGTTCAGTCTGGAGGAGATCAGACCTGGATCAG
CCGTCCTGAATCTGACAGACTCAACTTCATCTGCACTAAC
TACTGAGACAAAAGATGTGAGATTGTTGGTGTTTACTCAC
A

si:ch211-63p21.4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-63p21.4-201 (1)    Ensembl 1198
si:ch211-63p21.4-202 1081
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-63p21.4-202 Contained in:
[BAC] CH211-63P21 (1)

Genome Resources: Vega_Trans:OTTDART00000062995 (1),  Ensembl_Trans:ENSDART00000173246 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133850 (1) 1573 nt
CITATIONS (2)