ZFIN ID: ZDB-TSCRIPT-160112-553
Transcript Name: si:dkey-28d5.5-201
Previous Name: si:ch211-63p21.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062992 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062992|OTTDARG00000043413| CH211-63P21.3|OTTDARP00000049251 CH211-63P21.3-001 LG_ CT027762.14 Danio rerio protein_coding NOVEL, 1034 bp
ACAGAAACATCAGACTGAGGACAGAAACACACCAGCTCTG
AAAAATGGCTCAGACTCTATATTTCCCTCTTCTCCTCATT
GCTCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATC
ACTTCATAAATGAGAACAAGAACTGGACTGAAGCTCAGAG
ATACTGCAGAGAGAATTACACAGATCTGGCCACTGTTGAC
AACATGAATGACATGAACCAGCTGAAGAACAGTTTGGACG
TAAATTATGGAGTTGTCTGGATTGGTCTTCAGGGTACAAA
TGTTAGTAATTGGCATTGGTCTTCAGGTGATTCTGTGCTC
TTTCTGAACTGGGCATCTGGACAACCATACAGCAGTGATA
ATTGTGCTGTTATGATTAATGGAAAGTGGTTTGTTGGGGC
ATGTACTGCCACCTGGACTTTCATCTGCTACAACATGAGC
GGAGGACTGGTGTTTGTCAATCAGACGATGAACTGGAGAG
ACGCTCAGAGTTACTGCAGACAGAATCACATTGATCTGGT
CAGTGTGAGGAACCAGAATGAGAATCAACAGCTGGAGAAG
TTCATTAATGACAGTCAGATATCTGGATCTGCAGTCTGGA
TCGGTCTGTTCAGAGACACATGGCAGTGGTCAGATCAGAG
CAGCTCCTCATTCAGATACTGGAAACCTGATAAACTGATT
GTGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGAT
ACTGCAGACAGGATCATGTGGATCTGGTCTCGGTTCAGTC
AGTGGAGATGCAGCGTCGTGTGATGAACGTGGTTAAACTG
GCGTCTACTGAGGCGGTGTGGTTGGGTTTACACAACTTCT
GCAGCGTGAACATGTGGCTCTGGGTGAATGGAGACATGGT
GTGCTATCAGAACTGGGCTCCAGGGAACGGCAGCACACCG
GAAAACTGCAAACTGGAGAACAGAAAAGGAGCAGTTCAGT
CTGGAGGAAATCAGACCTGGATCAGCCTTCCTGAATCTCA
TAGACTCAACTTCATCTGCACTAACTACTGAGAG

si:ch211-63p21.3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-28d5.5-201 1034
si:dkey-28d5.5-202 (1)    Ensembl 1154
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-28d5.5-201 Contained in:
[BAC] CH211-63P21 (1)

Genome Resources: Vega_Trans:OTTDART00000062992 (1),  Ensembl_Trans:ENSDART00000138277 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133850 (1) 1573 nt
CITATIONS (2)