Transcript

si:dkey-28d5.5-201

ID
ZDB-TSCRIPT-160112-553
Name
si:dkey-28d5.5-201
Previous Names
  • si:ch211-63p21.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062992 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062992|OTTDARG00000043413| CH211-63P21.3|OTTDARP00000049251 CH211-63P21.3-001 LG_ CT027762.14 Danio rerio protein_coding NOVEL, 1034 bp
ACAGAAACATCAGACTGAGGACAGAAACACACCAGCTCTG
AAAAATGGCTCAGACTCTATATTTCCCTCTTCTCCTCATT
GCTCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATC
ACTTCATAAATGAGAACAAGAACTGGACTGAAGCTCAGAG
ATACTGCAGAGAGAATTACACAGATCTGGCCACTGTTGAC
AACATGAATGACATGAACCAGCTGAAGAACAGTTTGGACG
TAAATTATGGAGTTGTCTGGATTGGTCTTCAGGGTACAAA
TGTTAGTAATTGGCATTGGTCTTCAGGTGATTCTGTGCTC
TTTCTGAACTGGGCATCTGGACAACCATACAGCAGTGATA
ATTGTGCTGTTATGATTAATGGAAAGTGGTTTGTTGGGGC
ATGTACTGCCACCTGGACTTTCATCTGCTACAACATGAGC
GGAGGACTGGTGTTTGTCAATCAGACGATGAACTGGAGAG
ACGCTCAGAGTTACTGCAGACAGAATCACATTGATCTGGT
CAGTGTGAGGAACCAGAATGAGAATCAACAGCTGGAGAAG
TTCATTAATGACAGTCAGATATCTGGATCTGCAGTCTGGA
TCGGTCTGTTCAGAGACACATGGCAGTGGTCAGATCAGAG
CAGCTCCTCATTCAGATACTGGAAACCTGATAAACTGATT
GTGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGAT
ACTGCAGACAGGATCATGTGGATCTGGTCTCGGTTCAGTC
AGTGGAGATGCAGCGTCGTGTGATGAACGTGGTTAAACTG
GCGTCTACTGAGGCGGTGTGGTTGGGTTTACACAACTTCT
GCAGCGTGAACATGTGGCTCTGGGTGAATGGAGACATGGT
GTGCTATCAGAACTGGGCTCCAGGGAACGGCAGCACACCG
GAAAACTGCAAACTGGAGAACAGAAAAGGAGCAGTTCAGT
CTGGAGGAAATCAGACCTGGATCAGCCTTCCTGAATCTCA
TAGACTCAACTTCATCTGCACTAACTACTGAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations