Transcript

cr392330.1-201

ID
ZDB-TSCRIPT-160112-550
Name
cr392330.1-201
Previous Names
  • si:ch211-282j17.13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000062983 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062983|OTTDARG00000043407| CH211-282J17.13|OTTDARP00000049241 CH211-282J17.13-001 LG_ CR392330.9 Danio rerio protein_coding NOVEL, 1743 bp
GTGGATTTTGATCTTCAACCGGACTCTTGACAGAGCAAAG
GCTGGAGTACTGGAGAGAGACAGTCAAGTTCTTCTGCTGA
GGTCTTGCAGGCTACCATGAGTTCCAGATCAACTCTGATT
AATCAAGGTCCTCCAAAACGATTCCGTCTACATACAGAGA
GGAAAATACTTGATGATAATGGTAAAGTCAGAATATGGAG
GTATGGTACAAAAGACGCCAGAAAACAAAACAAAATTATT
CTGCTGGTGGGAGAGACCGGTGCTGGAAAGACCACCCTCA
TCAACTCTTTAGTGAACTACATACTGGGAGTGAAGTTTGA
AGATGAAACATGGAATGAAATCACAGAAGAAGAAGGAGGA
GATCAAACAGAATCCCAAACCTCTGAAATCACCATGTATG
AGGTGTTTCCAGAGGACAGTGCCATTTCTCTCACCATCAT
TGATACTCCAGGTTACGGAGACACTAGAGGACTGGAGAAA
GATCTGGAGGTTGCTGAAAATTTAGCTTATTTGTTTCAGA
GCAATGATGGAGTTCGAGAAGTCGATGCTGTGTGTTTTGT
GATTAAAGCATCTAATAATCGTCTCTCAGACAGACAACAC
TACATTATCAGCTCAGTTCTGTCTCTGTTTGGGAAAGACA
TTGTGAACAACATTGTGTTTTTAATCACACACTCTGATGG
TCTTCCTCCTAAAAATGTCCTCGGTGCCATTAATAAAGCT
AAAATCCCCTGCAGACGAGACAGAGGTGGCCAACCTGTTC
ATTTCATATTCAACAATCGTCAAGCTGATGCCCGTCACAA
TGAGAAGCGCTACATTCGTGCTCAAAGAGACGCCTGGGAA
GACTGTATGGAAGAGACAAAGCAGTTCCTTCAATCTTTGA
AAGCAAAGAACAGATGTAGTTTAGAGCTGACTTCAGATGT
CTTGATTCAACGCATTCAGCTAGAAGCTTCCATCAGCAAC
TTAAAACTGAGAATTCAAGAAAAAGAGTCGAAGAAGTCTG
AAAAAATTCAGATTCAGGAGGCAATGAGAAAAAACAAGGA
TAGGATTGAAAGAAGCACAAACTTTAGCATTAGATACAAA
ACGACTATCAAAACAAAGGTGCCCATTGTAAGTGCATCAT
GGAAGAACAGAAAAGCAACAACCTGCACGGTCTGTGAGGA
AAACTGCCATGAGCTTGACTGCTGGTGGGTTTCCAGTCCC
AAAAATTGTGAAGTCATGAGAGACGGCTTCTGCACCGTGT
GCACAAGGAAGTGCCACTACAGCAAACACGTCAAAGACAA
CAAGAAATATGTTATTGACACTTCAGACGTTGTGACTAAT
TATAACGAATTAAAAAAAGGTTATGAAATCCCACAGAATA
AGAGGTTTTCAGTTGCAATGGATGATCTTGATAAAGACCT
GAAGGAGATTGAAGATCAAAAGTATGTGATTGTGTTCAAA
GCTTACAAAACCATCAAGAATCTGTCTCAGGTGGCACTAA
AACCAGACTCCGCCTTCACCCTCCAGCATCTGGACTTCTT
CATCCCCAGAGTCAGGGAGGCTGGGAAAGAAGACTGGGCT
CAGGAGCTGGAGGAAATGAGGAGACAAGCAACAGCCGAAG
AAGCCAATAAAGACGTTCTGAGTTACCTGAAAGCTGGACT
CATGAAACTGTTTCTTGGTGACAAATGAACAAATGCAGAC
CAGATTAATCAATGAGGATGAAGAACATTGTTCAAGATGA
GATGAAATGGAGCAGGGGCTGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations