ZFIN ID: ZDB-TSCRIPT-160112-38
Transcript Name: dnajc11b-202
Previous Name: dnajc11b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain:
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062373 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062373|OTTDARG00000043090| dnajc11|OTTDARP00000048750 dnajc11-001 LG_1 CABZ01077678.1 Danio rerio protein_coding NOVEL, 1587 bp
AGGCTACTCAAGAAGAGTTAAAGTCTTCGTACAGGCGTCT
TTGTATGCTTTACCACCCTGACAAGCACAGAGACCCAGAA
CTAAAGAGGCAGGCAGAGCAACTCTTCACATATGTACACC
AGGCATATGAAGTTTCCAAGTTAAGTTATGCGTAATAAAA
TAAAATGATGCTAGGAAAAAGTGTTAAACACATGAAGAAA
GGGAGGTGTAAAAAGGAAGTGAAAGCCCAGACAGCAGCTG
AAATCTCTCAGTTTGTTACTTGCACAATTCTCCCCAAAAA
AATTGAAATATTTAATAATTTTATCTTTTAGGGGACAATA
AGCGTTGGCATAGATGCGACAGACCTCTTTGACCGATACG
AGGAGGACTTTGAGGAAGTTCCCGGAGGCGGTTTTCCCCA
TATTGAGATTAACAGGATGCACATTTCCCAATCCATTGAG
GCGCCGCTGACCACTTCAGATACTGCTGTCCTTTCTGGAT
CCTTGTCAACACATAATGGCAATGGTGGAGGAAATATAAA
CCTTTGTGTTCGGCGTGTGACCTCAGCAAGGGGTTGGGGA
GAGATGGAGTTCGGTGCAGGGGATGTTAGAGGCCCTTTAT
TTGGGATGAAAGTATTCAGGAATGTTACTGCACGCTGCTT
TGTGACTGCCCAATGGGGATTGCAGTTCTCCTCGCGTGGC
ATTCGACCCAGTGCCAGTACAATGATGGCTCGTCACCTGG
ACCAGAACACTATGGGCTACCTGCAGTGGCGCTGGGGAAG
CCAGTCTGCCATGACCACCAGCATCGTCAGAGACACCAAA
ACAAGCCACTTTACATTGGCCTTGCAGCTGGGCGTTCCTC
ATTCTTATCTAATGATGAGCTATCAGTACAAATTCCAGGA
TGAAGACCAGACCAAGGTCAAAGGTTCCATCAAGACAGGC
TTCTTTGGCACTGTGGTTGAATATGGTGCTGAGCGCAAGA
TAAGTCGCCACAGTGTTCTAGCTGCAACCGTCAGCATCGG
TGTCCCCCAAGGAGTTTCCCTCAAAATTAGGTTAAACAGA
GCCAGTCAAACATACCTCTTCCCTATTCACCTGACCGACC
AGATTTTACCCAGCGCTGTGTTTTATGCCACTGTGGGCCC
GCTGGCCATCTACTTAGCTGTCCAGAAGCTTATTATCATG
CCTTATGTACAAGCCCATAAGGAACAGGAGTTGGAGAAAC
AGAAGGAAGATTCTGCTTCAGAAATTGCTCGCAGGAAGCA
AGAGGCTGAATCTGCTGTTTTGTTGATGCAGGAGTCGGTG
AAGAGAATCATTGATGCCGAGGAATCTAAAATGGGTCTCA
TCATTCTTAATGCGTGGTATGGTAAATTTGTGTCAGACAA
TAGTCAGAAACGTGAAAGAGCGAAGGTCATTGATGTGACG
GTCCCGCTTCAGTGTTTAGTGAAAGATTCTAAACTCATGC
TTACTGAGGCATCAAAGGCTGGCTTGCCAGGGTTTTATGA
TCCTTGCGTTGGAGAGGAAAAAAGTCTAAAGCTGCTGTAC
CAGTTCAGAGGTGCAATGCACCAAGTGTTGTCCGGAGACA
CAGATCCTCTTAGGATACCTAAACAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS

Genome Resources: Vega_Trans:OTTDART00000062373 (1),  Ensembl_Trans:ENSDART00000173268 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC046897 (1) 2774 nt
CITATIONS (2)