Transcript

camta1-002

ID
ZDB-TSCRIPT-160112-37
Name
camta1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062370 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062370|OTTDARG00000043089| camta1a|no_translation camta1a-002 LG_1 CABZ01077678.1 Danio rerio protein_coding NOVEL, 142 bp
GCCGTCGTCTACTTCAACACCACAATAAACAGATGAACAT
GGACATTTGAAAATCTACTTGCCCAAGAAGCTTCTGGAAT
GCCTTCCCAAATGCTCCTCCCTGCCCAAGGAGAGACATCG
CTGGAACACCAACGAGGTAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations