ZFIN ID: ZDB-TSCRIPT-160112-31
Transcript Name: abhd6a-201
Previous Name: abhd6a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062352 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062352|OTTDARG00000043076| abhd6a|OTTDARP00000048727 abhd6a-001 LG_ AL929185.14 Danio rerio protein_coding KNOWN, 1438 bp
ATGTTATGCAGACATCTGAAGGCGCTTCTGTACGGGGTTT
TGTAAATATGAGCCACCGCGCGCCCCCTGACGGACTCTGT
TGCCTTTATGAAACAGCAATATAAACCGCCCAATGGCTTC
TTTCTGTTGTCAGATGTGCACCTGACAGATGTTGCGAACA
ATTCCCATCGACAGAGCATTATTTCTCGGCTGTTTTCCCC
TTTAAATTAGCGAACTTCCCTCTTGACGGCAAAGGGAGCG
CGCACGAGTGAACGCGCATCGGGTCTTCAGATCAAAGAGT
GACATGAGTCTGCTTTAATCGGCCTTCACTGGACATTCAG
ACACTCAGCGGACATTTAAAGGATGGATCTGGACGTCCTG
AACATGTTCTTGATTGCCGGCGGGACTCTGGCGATCCCCA
TCCTGGCGTTCGTAGCCTCGTTCCTGCTCTGGCCGGCCAC
GCTTATTAAAGTTTATCACTGGTATTGGCGCAGACGGCTG
GGGATGCAGGTGGATTATGCTGAATATGAAGGTTATCGAT
TCTGTTACTCTCACAGAGGAAATCCAGGCTTTCGTCCATC
TGTTTTAATGCTGCACGGCTTTTCTGCACACAAAGACATG
TGGCTCGGGGTGGTGAAGTTTCTCCCTAAAAATGTGCACT
TGATATGTGTGGACATGCCGGGACATGAAGGTACATCACG
CACCAGCGCTGTGGATTATTCCATAGAGGGCCAAGTCAAA
CGCATTAATCAGTTTGTGAAGAGCATTGGACTGAACAAAA
AGCCTTTCCATCTGATCGGCACATCTATGGGTGGAAATGT
AGCAGGAGTTTATGCAGCTCGTCACCCATCTGAACTCTGC
GGCGTCACACTCATCTGTCCTGCAGGTCTTCAGTATCCCA
CTGAAAGTAAGTTTGTTGAGCGTTTGAGGGAGCTGGAGAA
AACGCAGGACAGAGATGGGATCCCGCTGATCCCCTCCACA
CCCGAGCAGATGGAGGAGATGCTCAAACTCTGCTCATACG
TGCGCTTTAAGATCCCCAAACAGATACTTCAAGGACTGGT
TGACGTTCGCATCCCAAACAATGACTTCTACCACGAGTGT
TTTATGGAGCTTGTTGGAGAAAAATCCCGACACTCTTTAC
ACGAGAACATGCATCTCATTTCAACTCCTCTACAGGTTAT
TTGGGGGAAAAATGACCAGGTTTTAGACGTGTCTGGAGCT
TCAGTTTTGTCTGGAGCCGTTCCCGGATGCCAGGTTCATC
TACTAGACAACTGTGGGCACTCGGTAGTGTTGGAGCGGCC
TAGAAAATCTGCCCAGCTCATCACAGACTTCATCATCGCA
CAACAGAACGCAGGAATCAACAGCAACAAGAAACTCTCCT
AAAACAGGACGCTATACCTGCTTAAAACAGGTCTAAGTGG
TTGGTTAAAGCTGCAAACATAAAGGTTGTTCAGGAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abhd6a-201 Contained in:
[BAC] CH211-193L2 (1)

Genome Resources: Vega_Trans:OTTDART00000062352 (1),  Ensembl_Trans:ENSDART00000173312 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BF717990 (1) 553 nt
GenBank:AL920129 (1) 535 nt
GenBank:CR930577 (1) 529 nt
CITATIONS (2)