ZFIN ID: ZDB-TSCRIPT-160112-243
Transcript Name: ltb4r2a-202
Previous Name: ltb4r2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000063016 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000063016|OTTDARG00000043422| CH211-272H9.8|OTTDARP00000049267 CH211-272H9.8-001 LG_ CR847899.28 Danio rerio protein_coding NOVEL, 3986 bp
GGATAGTGTCAGAAGTATGTAAGCACCGGAGCGGGTTCAG
AAAACACTGAAGTAAAACAGCAGGAAACACTGATTTACCT
GAGGAGGAACTGCAGGAGAAGGAAAACTGACACATTTAAA
AACCCAGTCGTAGAGTTTCATCTACTGGAACACTCAGAAG
GTTGCCAAGATGGCGTTGAACCTTCTGTCCCCCTCTGCTT
TTCTCGAGATCGCTCCATCCTCCATCCCAATGGCCCTTCA
GAGTCCATCTTTCTACACCTCAACACTACATCCCACAAAT
CTCTCCAACAATACCAGCGGCAGAGGCAGCATCGTGGACA
ACAAAGGCGGAGCGATAACTGGTGCTGCAATCCTCAGCCT
CGTCTTCCTCCTGGGCGTCCCAGGGAACGTCTTTATCATG
TGGAGCATCTTGGCCCGAGCGCGGCGTCGCTCCATCACCA
CCCTGCTGATCCTGAACCTGGCCTTCGCTGATGGCTTCCT
CATGCTGCTCACACCCTTCTTCATGGTGTATCTGGTTCAG
CGAAGTTGGGTTTTCAGCCTGGCGCTGTGCAAAGTCCTGT
ACTACCTCTGCTGCGCCAACATGTATGCCTCCATATTCAT
GATCATGCTGATGAGTCTGCACCGGCTGGTTGCGATCGTG
TGGCCAAAGCGAGTAGGGGCGAAGACAGAGCGGAAGATGC
TGACGCGGGTGCTGGTGGGACTCTGGGTTCTCGCTCTGGG
ACTTTCTGCACCCGTTTTAGCTTTCAGGAACATCCTCAGC
GACAGTAAAAAGCCTGAGAAATTCGTGTGCGACTGCATCC
ATCCTGAAACACAATATGAGGTGATGCAGTACTCTATGGA
AACGTTGCTGGGCTTCTTGTTGCCGTACGGCGTGATCATT
GGAAGTTACACTTGTATCCTGCGCAGAATCCGCAAGACAC
GCTTTCGTAGACGCATTCGCAGTGAGAAGCTCATCCTGGT
GATTGTCGTCACCTTCGGACTCTTCTGGCTACCGTATCAC
ATCATAAACATGGTGCAGGTGACTGCCGCTTTACTCCCAG
AAGGATCTGCAGCAAAACACAGACTGCAGGAAATCAGGGC
GAATATGCGAGCACTCACCTCCACCGTGGCCTTCGTCAGC
AGCTGCATAAACCCTGTCCTCTACACATTCGCCGGGAAGT
CCTACATCCGCCGGGAGGGTCTGGCCTTCATGGCACGCCT
GTTTGAGGGAACTGCACTGGAATCCACACGCAAGATCCGG
AGGAGCAACCAGAACAGCAGAGAGCGGGACAAAGAGACGG
ACGAGGGAGACAGTATTAAAGACAAAGACTCTGATTCCAT
CAATACCATTAACGCAAACTCTGTTATCAAAGTTGCGCCC
CAGAAAAATGGAAAGTGAGGTAAGTCTAGTTGTGGTTCCT
GAAGGGAAAGTCTGTGGTGCAAGCAATGGATTGTATGTTG
TTTTAGTGTTGCGTGGTGAGTAAATTGGTACATCTTGCTC
TTCAAATTAAAAACTTTGTACCAATTACGTACCAGAAAAA
TCACAAGAGAACAAGTGGACCAGTGTCTAAGACAGAGACA
GAGGACTGAGAGCGGCAGGTCTTTATACATAATGAGCTAA
ACAAGAAACAGGTTGAAACAATTACTAGTTTACAATCCCG
TGAAGAGATCAACCTGGAATACTTGGAGCTTTGTTTATTC
CTGCTCTGTCTCTTTGTCCAGGAGAGGGCGCCACAAAACT
GACACAGGACATCTGACAGAAAGAGACCAGTGTTCTTTAC
ATCCGGACCCTGAGTGGTGTCAAAGGTTATAACCAAATAC
TCAAAACTGGCCCAGTCAGATAAGTTTGGCCGCATTCTAA
GATTTAAGATGGAAGTTGTTGTTTGTGCTGGTAAACGATG
ACAGTTACTTCTAAATTAATAGTAATGCTTTTCCCACAAC
ATTTGCTTTGTTGTACTACTGGTTATACGGAGTTTTATTA
TTACTTTGACATTCATTTTACTAGTGTAGAAATTAAACAC
TCTAAAAAAGGTTCGTCAGTGGTTCTTTGGCTTGTAATCC
TAAGTAAGCCCTGCTGAAAAATCCAACTTAAACCAGCCTA
GGCTGGTTTAAGCTGGATTTTTTAGCAGGGAGTACGATAT
AGAGCCTTAAAAAAACCTGTAATGCAAGGGTGTCAAGCTC
AGCTATGTAGAGTTTCGTTTGAACACACTCAAGCCGCAGT
GACACAAGAGCACAGGTGTCAAAGCCAGTTCCTGGAGGAC
CACCGCTCTGCACAGTTTAGTTTCATATCTGGTTAGAGCT
GTTGCACTCCAGGAACTGGCTTTGACATCTTCGCACTAGA
GTTTGAGCGTGCAAAATTCTGTCAGATGACACTTTGAAAA
ATTACAAGTCAAAACTGGTATGATGTGACAGATATAATTA
AGTGATTGCTCCATTTTTTTGCATAGAGGGGTCATGTTTT
GATCTTTATGTGACATGGAATCGCAGGTCAGAGTTCACCA
AATTCGAACTATGAATGGAAGTCAATGAGGCTAAAAGTGT
GGCTGCGGCTTTTATCTATAGGTTTCAAACAAGTCTGAAG
GACTCAATTAGTTTGATAATGTGTGTTTAATTAGGGTTAA
CGCCAGCGTTGGGTAGTAGCATTGCTACATGTAGTGATGC
TACTAGCTTAACTCCATTTCTAGATCCGTGGCGATAGAAT
TACTACTTTCTAAATCAAATAGTTTTTTTTGTAGCGAAGC
TATTTTATTAGTCAAGTAGCACAGTAGCGTCCACACAAGT
TACTTTTCGCAGATCAATAAGTGACTGCACTGACATTCAC
AGAGCTGTGAGGCCACTGTCTAGCCGATGAAAGGGAATCC
ATATGATGGTGAGAATGATGATATCTTTTCTTCTTCATGT
TTTTCGGTGGTCGAAAAAAAAAAGGTATTGATGCGTTACT
ACCACCTCTTGCTCTGGTCGGTGAACCAATCAGACTAACA
AGAGAAATTTGCTTGATGGAATGATGACTGAGGGAGAGGA
GTTATTTCTGAAGCAGGATTCCTCGTGACCATACCTCTAG
AAGTACATGTTAAGATATTATTGTACTATAATAAGATACT
ATAATTTGTATCTGTTTAGTACAGCATATTATTTCAAGTA
AATAACTGAACTGAACAATTCTGCCTCATATGTTCATTGA
CGGTTTTATCGATCACTAAGATATGATTGACTTGGATTTA
AGTTGCTTCGATTTAAAAATGAAAATTGCAAAAATTGCTT
CGATGTAGCTAAGCTACTTTTTCCATGTAGCTTTTAGCTT
AGTTCGCGACAATTCATAGAGTTAGCTACATTATAAGTAG
AGTAGCTAATAGCTTAGCTCACTCATTTTTCAAGTAGCTT
GCCCAACACTGGTTAAAGCTACACCTTACAGAGCTGCAGT
CCTCCAGGAGCTGAGATTGACAACCCTGCATTAATGGTTC
TGCAGGTTCTTTAAATTAGTCAAGGTGCTATATAACATAG
ATAGAGGTGCTATGTAGCACTAAAAGGGACAGTTCACCCA
AAAAGGAAAATTCCATCATTTAATGACCCCTGAGTCCGTT
TTTTTGTTAAACACAAAAGAAGATATTTAGAAAATTATTG
TAATCGTGTAACCACTGACATCCATAGTAGAAATTTTCCA
TAGAAGGGGAAAAAAAAATACTATAGAATTCAATGGTTAC
AGTTTTCTAACATTTTTCTTATGCTATTCAACACAACAAA
AGCAAACCATAAACTGGTTTATTTTCATTTTTGGGTACTA
AAGTTACTATGGAAACCATCACTGTAAAGTTGCTTTACCA
ACATTTGTACCTTAATGACTGTACATGATTTTCTATTTGT
TAATTGATCATATTTTTCATGACAACAAGGAAAATTGTAA
ATGTATTTGAGTTTTTATGATGTCTGAACTGCTGAACAAG
TGCTTTTACTATTTTCAATATATATAATATTACATCCTTC
AAATAAATGTGATGTTTGGTCATCGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ltb4r2a-202 Contained in:
[BAC] CH211-272H9 (1)

Genome Resources: Vega_Trans:OTTDART00000063016 (1),  Ensembl_Trans:ENSDART00000173390 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)