ZFIN ID: ZDB-TSCRIPT-160112-238
Transcript Name: si:ch211-63p21.8-201
Previous Name: si:ch211-63p21.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000063000 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000063000|OTTDARG00000043418| CH211-63P21.8|OTTDARP00000049259 CH211-63P21.8-001 LG_none CT027762.14,CR383683.17 Danio rerio protein_coding NOVEL, 7057 bp
AGACACTATAATTAGCATGTTGTTGACTTGGGAGAAATAC
AGCATGCAAGATCTCAGACAAGAGCGAGCGCTGAAAACAG
AGACCGACAATAAGGAGTATTACTAACACAGGAACAGAGG
AGAAATATTACTACAAGAAGAAATCCCAAAGGAAAACAGA
AAAATAAGGAGAAGTAACGCTAAAACAAGAACAAAGCCCA
GAAGAAAACACCACAATCAGGAGAAGTAACACTAAAACAA
GAACAAATCCCAGAGGAAAACACCACAATCAGGAGAAGTA
ACACTAAAACAAGAACAAATCCCAGAGGAAAACACCACAA
TCAGGAGAAGTAACACTAAAACAAGAACAAATCCCAGAGG
AAAACACCACAATCAGGAGAAGTAACACTAAAACAAGAAC
AAATCCTAGAAGAAAACACCACAATCAGGAGAAGTAACAT
TAAAACAAGAACAAATCCCAGAGGAAAACAAAGCACAGAA
TTGTTGAAACAACAATACATCCCAGAGGAAAAGACAGAAA
TATGAAGAAGTACTGCTAAAGCAAGTATAAATCGCAGAGG
AGAACACAACAACAAGAAGTAATAATAAAACAAGAATAAA
TCCAGAAGAAAAAAGAAACTTACTAAAACAAAAATAACAT
CCAGAGGAGAACAAAAAAAAAAAAAAGGAAAATGTTTTAA
TAAAACGAATAAAATCCAGAGAAAAACAAAAGCACAGAAT
TGCTGAAACAACAGTGAATCCCAGAGGAAAACACCGAAAT
ATGGAAAAGTATTACAAAAACAAGAACAAAGGAGAAATAT
TGCTAAACAAGAATAAATCCCTTAGGAAAACTCGACAATA
CAGAGAAGCAACACTCAAACTAAAATAAATCCCGGAGGAA
AACACAAGTATTATTAAAACAGCAATAAATTCCAGAGGAA
AACACAAAAAAAGGAGAAGTACTGCTAAAGCAAGAATACA
ATTCTGAGGAAAACAAAACAGTAAGAAGTATCGCTAAAAG
AAGAATAAATCGCAGAGGAAAGACGACAATAAGGAGAAGT
TTTACGAAAACAAGAAAAAAGGAGAAATATTACTACACCA
AGAATAAATCCTGGAGGAAGACACGACAATACAGAGAAGT
AACACTAAAACTAAAGTAAATCCCCGATGAAAACGCAACA
ACAAGTGTTACTAAAACATGAACAAATCCTAGAGGAAAAC
ACCACAATAAGGAGACGTACTGCTAAAACAAGAAAAAATC
CCAGAGGAAAACGCAACAACAAGTGTTACTAAAACAAGAA
CAAATCCTAGAGGAAAACACCACAATAAGGAGACGTACTG
CTAAAACAAGAAAAAATCCCAGTGGACTTGACAAAAATAA
GGATAAAACAATAATAAAATTCTGAGGAGAACACCACAAT
GTGGATAAGTATTAACAAAACAAGAATAAATCCAGAGGAA
AACACAAGTGTTACTAAAACAAGAATAACATCCAGAGGAG
AACAAAAAAAGAAAAAGTAATAATAAAACAAAAAAAAAGA
GAGGAAAAAGCACGACAATACAGAGAAGCAACACTTAAAC
TAAAATAAATCCCAGAGGAAAACGCAACAAGTATTACTAA
AACAAGAACAAATCCCAGAGGAAAACACAAAAAAGGAGAA
GTACTGCTAAAGCAAGGATAAAATTCTGAGGAAAACAAAA
CAGCGAGAAGTATCGCTAAAAGAAGAATAAACTGCAGAGG
AAAAGACGATAATAAGGAGAAGTTTTACGAAAACAAGAAA
AAAGGAAAGCACAAACATTCTGAGCAGAACACAACAATAT
GAATAAGTATTAATAAATCAAGAATCAATCCCAAAGGAGA
ACAAAACATTAAGTATTAGGTACAAAACTGATTTAACTCA
CAATAAGGAGAATTATCACTTAAACAAGAATAAAATCCTG
AGAAAATTATGACATTAAAGGAAAGTATTGTTAAAACAAA
GATAAATTCCAGAGGAGAACACAAAAAATTGGAAAAGTAT
TACTAAAACAAGATTAAATACAAGAGGAAAACAAAAAAAA
AAAAAAAATATGGAGAATTAATCCTAAAACAAAAATATAT
CCAAGAGGAAAACATGACAATATGGATTATGTACAAACCT
GATTGACAAAATTGATTGTAACCACAACAAGTATTACTAT
AACAAGACAAAAGTCCAGAGGAAAACACAAAAGCATGGAG
AGGAATTACTAAAACAAGAATAAAATCCTAGAGGAAAACA
CCACAATGTGAAAAATATTACTATAGAACTACTCAATAAT
AAAATCCAGAAATATAGCAAAACATTTTAGCTAAAACAAA
CATAAAATCCTGAGGAAAACACAACAATAAGTGGAAGTAT
CCTTAAAACAAGAATAAACCCCAGAGGAAAACATGACAAT
ATGGGTTGTGGACAAAACTGACTGACAATAAGGAGACGTA
TAACTATAACTAAAGCAAATCGAGTGAGAGGAGAACACCA
CAACAAGAAGTATTACTGAAAGAAGAAACAAACTGGGGAA
AACTCAATATGGAGAAGTATTAATAAAACAGAGAAGTATT
ATTAAACAGAGAAGTATTAATAAAACAAGAATAAATCCCA
GAGGAAAACGCCACAATAAGCAGTAATACTAAAACCAAAA
CACTCAAGGGATGGAGTTTACACGAAAATATCTGCCCCTG
GAATGGGAGGAGCGCTGGAGGAGAGAGAAAGAGCGCAGGA
AAAGGATGATGGAAGAGGGAGGAGAGAAGTTTGAGGAGGA
GGAGAAGCGAAGGTTAAAGTGGATCGTGTCCTACAACGAC
GGCAGGATGGGAATGAAAGAGAAGGATAATGAACACGGTA
ATGCTGAGGAAGATGAACCAATGCACAGGTATCGCAGGCA
GAGTTATGCAAGTGAGATCCATCAGACTCTATTGGAGATG
AAGATGGCGGACGTTCTCACAGATCTGACCCTCAGCACTG
AGGATGGGATGAGCGTTCGTGTTCATTGGCTTGTCCTGGC
CGCGGTGAGCTCCATCATCCAGGAGAAAGATGAAGATGTG
AAGGAGATCTCGTTGAGTCCTGAGGTGTGCAGGTCTGGTT
TGGTTGCAGTGGTGGAGTTCGCCTACACTGGAGGCATCAG
TAATCTGAATATAGACAACATGATGCAGATTCAGACGGCA
GCGGAGAGTCTGGGAGCTCCAAGAGTCCTGGAGCTGCTCA
AAAAAGAGAATAAAGGAGATGAAGTGAGGAAGAGCTTAGC
TGAAGAGCAGATGACGGTCGGCCTGCAGTGCATGAAGGAT
TTTTGGGATAAGAGATTGAGGTGTGATGTGAAGCTGATTG
CTGAAGGAACTGTTTTCCACGCTCACAGGGCGCTCCTGTC
AGCCAGCAGTGAATACTTCAGAGGGATGTTCACCAGAGGG
ATGAAGGAGAGTCGTGAGGAGTCTGTGTCTCTACTATCAG
CCGGAGCCGCTGAGCTGGAGATCCTCCTCAAATGCTGTTA
CAGCGGTGCTCTGGAGCTCAGCTGGAGCTGTGTGTTTGAG
CTGACCTGCACCTCTCTGCAGTTCCAGTTCCAGCCCGCTG
TCTCGCTCTGCCTTCAGTTTCTGCAGCAAGAAATGGACGT
ACACAACTGCCTAGATGTTGCGTCATTCGCTGAAGCCTAC
GGGATGGTGGATATAATGGAGATGGCTGAGGATTTTGTCT
TGAGGCACTTTCAGGAGATTTCAGCCACCCCAAAGTTCCA
GGACCTGCCAGCAGATAAGCTCCTGCAGTTCCTCCGCTGT
GATGCTTTGTCTGTACCGTCAGAACTGGCGGTTTTTCGAG
CGGTTGTGTCTTGGATTGAGACTGATCCTGCTGAGCGTCT
CCTGCAGGCTGAGCAGCTCATGAAAGCAGTGCGTTTCCCA
TTCATGACCTTCAGAGAATTTCAGGAAGTCCGAGCAGTTA
ACCTGACCATGGAGTGTAGCGGGGAATACGACGTTGAACT
CTATAAATCAGCGCTGAAAGAGTTTGGCGTTTCTGATCAT
GTAGCACAGCAGCGTGTTCGTTACCCAAAAGACGCTCTGG
TTTTGGTTGGCGGTGATGAACTGGATGCTGATAATGGTCG
AAGGCGGCCCAGTAAGCAGCTCTGGTTTGTGAACTCTCTG
CGGAGCGGGACTGGACTTGTGAAGCAGATGGAGTGGAGAC
TGCTGGGAGAAATGCCAGATCAGGCCAGATTCAGACACGG
CGTTGGAGTCCTTAATGGACAACTATATATCGCTGGAGGA
TGCTACTTCTACTCAAAGGCTGACATCATGAAGTCTGTGT
ACAGGTACGACCCTGTGCGAGAGCAGTGGGAAAAGCTGTC
AGATCTTCTGGAGCTCAGGAGTAACTTCACACTGGTGGTG
AATGGAGAAAACCTGTACGCAGTCGGAGGAGACAAAGAAA
TCAACACAAACCTGGACAGCGTGGAGAAATACTCACCAGA
GACTAATTCCTGGAGCTTCACTCATCCTCTAGATCAAGCC
TTAAGCGGTCATGCTGCCACCGTCTGCGGAGGCGAAATCT
TCATCTCTGGTGGTTTTAATTGCAAATACGAATGCTTGGT
GTCCATGTCTGCCTACCATCCTTTAAGAGGAACCACATAT
CTCTCGGATATGATCCACGATCGGGCCCAGCACTGCATGG
AGAGCCTGAGGAACCGAATATATGTGGCCGGCGGAGTGTG
CAACCTTCGGAAATTCTACACCAATCAGCTATCCTGTGAA
GTATACGACCTCGTACATGATGTCTGGACTGAATTCACTG
CTTTGCCTGTGCCTCATGTTGGCGCTGCCTCTGCAGTTCT
GGAGGAACGGCTGTATATTTTGGGTGGATACTGTCAGGAG
GATTATAGTGAAGCCAGACTCGCTCACAGATATGACCCTG
TGACGCACAGATGGGACAGCATGGGGAAAATTCCAGGTCC
TGTCACGGATATACGTACATGTCTCCTAAAACTGCCTGAA
CACATCAGAAAATAATACAATTGAGGAGTATGTGCTTGTT
AGGGGTGTCCGGACTGATCCTAAAGTATCGATATGGGCAA
AATTGTCATTATTTACTATCAAATTTTCAAATATTTACTT
CAATAGGAAAAGCATTAGAACTATAATATTCTGTTGTATC
TCTACTAATGGGTCAGTGTTTGCTCACAGACACACACAGT
TGTATACATGGTTTAGAACAGGGTGGTCAAACTCAGTTCC
TGGAGGGCCGCAGCTCTGCACAGTTTAGTTTCAACCCTAC
TCAACACACTTGCCTGTAGGTTTCAAACAAGCCTGAAAGA
CAGGTGTGTTTTATTAGAGTTAGAACTAAACATGTCCTGG
TTTAGAGGGAAACTCCATAGGCTTAATGTATAGACCTTTT
TCTTGGCTGCTGATTGGAGGGCGCCATAGCGGCCAGCTTC
TTCCGGTAGAATGGTTAGAACTTCTGTTTATAGCGTTTAC
AACTGGTAATTTGTGCTCCGAAAATGGGTTTCAATAGTGT
TTTTAATGTATTACGGAGTGTTTTTGTGACACACGACTTA
CCGTACGTTCACACCGAAAGGGGCGAGAACGTCCAAGGTT
GCTCTGGCCGCCCTGGCGACAACGCTGCCTGCCTTCAGCT
CCGGCGGCGAGAGCGTCAAAACTCGCTACATTGATCTCGT
ATTTAAAGGAGCCGTTGCAGCATACAGTTACATTCCTGCA
TAAAACATGTTTCTAGCGTGAAAATGTTGCGCACTTCTTA
TCAAATTCATATAACGATGGAAGATCAATTTGCGTGTGGT
GTGGCTTTGCTCCGTTTATCCAATATGTGTCCATATGTCT
GAAATATCCTGAAGCAGCTGTACTGTTTTGTACTGTCACG
TCGCGTGAGTATATAAATATAACATTAATGAACATCAGTA
ACTCGCCAGTAACTTATTAAATGCATGTTCCTGTAAGAAA
ACATTGTAAATAATTGGAAATCCGGCGACCGCAATCATCA
AACCCTTGGGAACAACTGCACTGAAAAAAGTGTTGCATGC
AGAACTGTTGCAAACAATTTATTTGTGTTGAATTTAAACA
ATCAAATTAAATTGAATAATGTTCAACTTAATTTGTTTGT
TTAAATTCAACACAATTAAATTGTTTACAACTACTTAACG
TAAAAAAATTGAGTCAATCAAAGGAATCATCTTTGAATAA
TTTTTTTCAGTTTGTGGCCGTAACCAAAGTTCACAGATCT
GTGTTCTCTGAACTCGTATCAAGCGGTGGACGTCTTCATT
CTGATTGCTTGCCGCCGAACCGCGTCATAGCTCATTACCA
TAAAGTTGACTTGATTTCAACTCTCCTCGACGCTCACACC
GGCGAAGACGCGCCGCGCAGCTCCTTGCCGCTTATCGCCG
CCGGCTCTCATTGAAAATGAATGACTTCCGGCTACTTTGA
CGCTCTCGCCGCTTTCGGTGTGAACGTACGGCTTGAAAGG
TGTGTGTTAAAGCCGTTTGTAATAAATTTCATGGCCCTTT
GGCCACCGGGGAGGAAGAGGTGGAGAACGCAGTTTTAAAA
TATTTATTTATAACATGAAACATTGGTCTAAACCAAAACA
AACGGAGGGCAGCTCCTCACGGAGACTGCCATCATACTGA
AAGCAAAAGTAAAATATGTCCGGGTCCGGTCCTCTCTCGG
CTTCCTCTGCCATCGTTCCTCCTTTTATAGTCCAGAGCTC
CTTCCGTGGGATTCGAGGCCGGTGCGCACCGCAGGTGTAT
CCACTTACGCGGCAGCCTCATTCCGTTTCCACGGCTCTCG
GCCACGCCCCCTCGCCACACCATGATAATCTGTCAGATGT
GGTTCAAACCTTGGAGAAAAACGTTCGCCTAGTTCATGTG
TCTGCCATAAGAAATACAGTGTGTGTGTTCCCGACCTGTC
AGCTGTTAGCTCAGCGGCTCTTCAACACACACACATACAC
ACTCACACACACACACGTGCGCAATACTTCACTGCATTAT
AGAGCAAACCAGATTACTGGCTTGAAACTTAACAGGTAAC
ATTATGTAAGTCATGCAATTTACAAAAATGACCAATAAAA
GTCTGTTATTGATCCTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-63p21.8-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000063000 (1),  Ensembl_Trans:ENSDART00000172762 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)