ZFIN ID: ZDB-TSCRIPT-160112-235
Transcript Name: si:ch211-63p21.2-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062991 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062991|OTTDARG00000043412| CH211-63P21.2|OTTDARP00000049249 CH211-63P21.2-001 LG_13880 none CABZ01079166.1,CT027762.14 Danio rerio protein_coding NOVEL, 2085 bp
ATCGAGCCCTCGTATGAGGGTCTGGGAGCCAAACGGAGCA
GCACGTCTCACTCTTGGTCTCCAAAAGACTGAAAATGAAG
AGTTTCTGTAGCATCTGACATACTTTAGGAGCTCAGAAAG
TGCCGAATACACCTGGATGGGGAGCTGACTGAATCCTGCA
GACTTCGTGTCTTTACCAGAGTCTTGAAATCGTAACTATA
TGATACGATAATCGCGGTGACCTAAATTTTGTCTTTTTTT
TTTTGTACAACGGAAAACTGAGGAACATTCATGAGGAAAT
TTTGAGGATATTTGTCCATGAACATTGTTCTTAAACAGCA
TTGGGGAGAAAAAAAAGCGTATAATATACTACTTTTCCCG
GACACTATTATTGTACGAATTTTCACTGAGGTAAAAAATT
CCTGCTGTATTTAGTTTTAAAAATTTAATTGTAAACTTTT
CGCAAAAAAATTAATCACCAAAAAGACCAGATGAAACCCG
CTGAATGTTTCCTTCTGAACTCCTCCTGGACTTCCCTCAT
TAGCCACACCCCTTTGCTCCGCCTGAATGCTCTCGACTTT
TCCGACCTATGGGACGACGAGGATCTTGAGCTGGACAGTA
TTGATGGCGACTCCACTCACAATTCACCCAGTCAGACGAC
AGCCTCCCCCATGGTTCCGCCCCCTCCGCCTTTAGCCCCA
CCCGTATCTCTAGCCAGTGAATCACCGTGGTCGAGTCGTA
CTCTGAGGCTCCACTGGAGGGCGCTGCTGAGTCTACAGCC
CTTACCGAGAGTGGGCCGATTTGGGCCACAGTCCATCTGG
GCCACTCTGGAGCCTGTTCATCTGGACACCAACAGACTGG
AATACCTGTTTGAGAGCAAAAATAACAGCGCCCTCTGCAG
TCTCACAGCAGGACGACAGAAGCAGTCATGTGTGTGTGTT
CTGGGTGTAAAACGCAGTAACATCATCACTATAGCGCTCA
GCCGTCTCCCGCCGGCTCACCTGCTGCCTCCTGCTATCCA
CAGCATGGACAACACTGTGCTGGACAGAGAGGACATACAG
AGGTTGCAGACTCTGATTCCCACTGAAGACGAGCTGAATC
TGATAAAGGAGGCGAAGGCTCGGGCCCCGTGTTCAGCTCT
GGGCTCCGCAGAGCAGTGTCTCCTGACCCTGGGGGACGTC
CCTCATCTGAGGGCCAGACTGCAGCTCTGGGCATTCACAC
TGGACCATGACACACTGGAGAGAGAAATTGCAGAGCCGCT
CTTTCATCTGAAGCTCGCCATGGAGCAGCTGGCGACCAAT
CAGACGTTTCGATGCATCCTCGCAACTGTGCTGGCCGTCG
GGAACTTCCTAAACGGCTGTAAGGCCAAAGGGTTTGAGTT
GAGTTACCTGTGCAAACTCTCTGAGGTGAGAGACACTCAC
GGCCGACAGCCTCTCCTGCATCACGTGTGTGTGTTACTGC
TCCAGATGTACCCACAATCCTCTGATCTCTACTCTGACAT
CACTGCAGTCACAAAAGCCAGCAAGTGTGACTATACGCAA
GTTCAGCTGAATCTCTGCCAGCTCGAGGTCCTTTGCAAAG
CATCATGGGATCAACTCCGACTTCTTGAGAAGGATGGAAA
GAAGAGGAAAGGTGGAGGAAGGAAAGATGGATGTGTGGAA
GAGGCATCATCCCTCCATCAACAGCTCCACCAATTTCTGA
AAGACTGCGAGGAAAGACTGAAGGTGCTGCGAGCTGTTTA
CCGCAGAGTCATCAACAGATTCCACTCGTTCCTGCTGTTC
CTGGGTTACTCGCGCTCCATGGTGAGAGAAACCAGTGCAG
AGGCGTTTTGTAAGACCGTCAGCGACTTCGCTCTGGAATA
CAGAGCCACTCGCAGTGCTATCCTCCAACAGAGGGAGAAG
GAGAAAGAAAAGGAAAAAGGGAGGAAGAAAGACAGCCAAA
GCACACCTGAATTCAAAATCAAACTCCAGCAAAGTCCATC
TGATGAGAATCAAGAGCAGGTGAAGCTTGAGGAGGTTTTG
AAGACTCCTGATTCTTCATCATCCTCATCTTTCCACTTTG
ACTTCACTCTTCCACGACAACGCAGCAAGTCGAGCGACAA
GAAAG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-63p21.2-001 Contained in:
[BAC] CH211-63P21 (1)

Genome Resources: Vega_Trans:OTTDART00000062991 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)