Transcript

lrrc38b-201

ID
ZDB-TSCRIPT-141209-920
Name
lrrc38b-201
Previous Names
  • lrrc38b-001
  • dkey-161f11.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061301 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061301|OTTDARG00000042464|ZDB-GENE-141216-65 lrrc38b|OTTDARP00000047474 DKEY-161F11.1-001 LG_ BX649345.16 Danio rerio protein_coding NOVEL, 3026 bp
TTATGTTGGACCAAATGTTTTTCTAGATTTGTTGATATAC
AGGATAGATTTTAAAATTGTGGAGGAGGATATAATAATAC
AAATGCACAAAAACATGAATGCATGTAGAATCTGTTGTAA
TTGTGTGACCATTTATCTCACTAGGAAATGACATCACGTG
TTGAGTGCATGCTCGACTCATCCCTCCATATTATACAGCA
AAGACAACACAGGACAAAAGCACTGGAGTCCATGAGCCAG
CATGCTGGTAGACTTCCCCCGTTCCCCACGCTGGTCTCTA
ATCTGCATGCAGACAACTTCTGTGTGGATATTTGGATTTC
CTCACCATAGCAACAGAGCTGCGAAACCGTGCTGTACAAC
CTCTCATCAGACAGAGTCGTGCCTGAGCATCGTACAGCGC
GCGGGAGCCAGACCAAAGGAAGACAAGAAGAGGAAAAAGA
GAGCGGTGAAGAGGACACCGCTGCACCTCATTCTCTGTGG
GAATTCTCCTCATTAGGACCATGACAGCTCAGTTACAACG
GCTCCGAAGTGCCAAGGGTCATGTTCACAGCCGCCAGTCA
AGCAGTCATTCCAGCGCTCAGCTGAGAGACAAATGGAGGG
ATGCAACAATTTTACTCTTTGCTCACCATGACCGAGCCTC
TCTATGCTGAATCCTTTTGTGTCAGACTGCCAGGATTCGA
CCAAGCGCGGGTTAATTGCGAGAGAGCGGCTGGAAGAGCC
CCCTCCTCTTCCACGCTGCCAATCTGTCCGTGCCTCCGAT
TTTCCACTCATTCTGCCTTTCTGGTCTCTGTTTACCTCTG
TCTGCTGATTTCTCCACCCCTTTCCCTCTGTCTCTCATGC
TTTGGCACTCCCTCCCACAGCTCGCTATCTCTCCTCCCCT
CGTGCCTTCAAAGCCAGCAGTCTGCTCCTCACTCCAGGGC
TGCTTGCTACATGATCTCTCGGAAAACAGCGTGCACGTCT
TTCTCGAGCAGCTCCATGTGCAAGTCTTGAGATTTCTTGC
CCAGGACGGCAGGATGCTCCTGCGCTGGCACTGATTCCTC
TATTTCTCTTCTCGACTTCCCCTTCCCCTCCCCTTTCCTC
ATCTCCTGCCCTCTGACCCTCATCCCCTTCACCCCTGACC
CTATTTCCTCTCTTTTCCATTTCTTTATTGACCATGTTGC
CATGTGTCTACCGGCTCCAGCCTGTCCTCACCTTGCTCTC
CTTCACTTTGTTGACTCAAGGGGAAAACTGTCCAGCCATT
TGCCTTTGCCCAGACCCTCACACTGTGGACTGTAGTGGGC
GCGGACTTACCCGTCTTCCAGACGAGATCCCCTTGGATGT
GCGGAGGCTGCTTTTGGCGGACAACTGGATCCCCCGGATT
CCTTCGGACTTCCTTGTGCTTTACAGCGACCTGGTCTACT
TGGACCTTCGCAACAACTCACTTTCAAACATTGAGCCAGG
GACTCTTAGCACTTCCTCCAGGCTGGTTTTTCTGGACCTC
GGCTGCAACAACCTGACGGAGATCCCCAAAGGGACTTTTG
GAGAGTCAAGAAGCCTAATTAAGTTGCGCTTGGGCAACAA
CCCATACTTGAGCATGGTGAATGAAGATGCTTTCATGGGT
CTTACTTCTTTGCGTGAACTAGAACTAGAACGAAATGCCC
TGTCCGGGTTACAGGTGGGCGCCCTGAGCCAGCTGCCCTC
CCTTCGGGTAGTAAGGTTAGAGGGCAACCCTTGGGTGTGC
AACTGCAATTTTGCCAACCTGTTCACTTGGCTGGAGGAAA
ACAGTCACAAGCTTCCCAATGGTATAGATGGTATGGAGTG
CTCTTTGCCCACGGATGGACGCCGCGTGCCTCTAAGCCAA
CTCTCCCAGGACAGTTTTCGGGAGTGCCAGATCACCCTCA
CTCTCACCGATTTCCTCATCATCATCTTCTCGGGCATCTC
CGTCTCTGTGGCCGCCATCATGGCCAGCTTCTTCCTGGCA
TCCACCGTCCACTGTTTCCAGCGCTGGAGCAAGGGCACTA
AAGGAGATGAGGAGGAAAGTGAAGAATGAGGCATGAGAAT
GACCTTCAGTGTGATTCAGAGCTGCCAGATCTTGACACGA
GTTCAACAAACAGCACGAGTGAACGGACACCAGGTAGAAC
TTGAGCAGAAATAGCCTGAGTGCTAATAAATATGGACGCG
GTTCCCTCACAATCAAAGGATAGCAAGCCTTAGTATGCAC
AACTTCCAGGGATTTACGTGTTAAAGGAAATTCCTCGAGA
TCTTGTCCTGCAGTATAGAGTTCTCAGTGTTGTTGTCTGT
AGAGTTTCTTCCTTTGTGTAGTCAATATAAAGTTAGCGAA
TTAAACCGTGCTACTTGTTGATTGTGCCAAATTATCACAG
GTAGGCAGCGATGGTTCAGACGAGCGCTGATGATGAAGAA
CAGCTATATGAAGTCATGCAAGGTGAGTCAGAAGTCAAAC
GATTCAGCTTTATCCAGCCAAGTGTACGAGACGGAAGCCA
TTTTCCTTCCATTTTAACAGGAATATGAGCTAAGAGAGAT
TTCAGAAAGCCTCGCCTGAGATTAAAAGTTTAGAATAGAG
CTTCTTGTGAACAGTCGTGTCAAATGCCGCACTTTAAAAT
GGTCCTACCTAAGTTAGACTGGCCCTCAAACCACTAGGTT
ACACTGGTTCTGTCCAGATCTGCCAAAGAACGCTTCGACT
GAGGGTTTTCAAATATAGATTTATTTTTCTTTAAAGAAAG
TCTGTGATCTTAGCAAAGATTGCATTTATTTCGTGTAATT
ATGGTAATACTCACATATTTACCCTTAATGTGACAAAAGA
CAATATCTATGAGATGGAAATAACTACATACTACAGATGT
CATTGTATTATTCATGTCTTAAAGGTGTATTTGAATAAGA
TATACAGTAGGCCCAAAATATATTTTGACATTGGAAGTCA
AGTGTGCGCATTGCCATTGTCAATACGTAACAAAAAATCA
ACACATTAAAGGTGCTGTATGTAAGTTTTTGACTCTTGAC
GCATAAAACGCCACAATATGTTTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations