Transcript

brpf3a-202

ID
ZDB-TSCRIPT-141209-912
Name
brpf3a-202
Previous Names
  • brpf3a-001
  • ottdart00000061263
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061263 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061263|OTTDARG00000042442|ZDB-GENE-130530-730 brpf3a|OTTDARP00000047430 brpf3-001 LG_ CR933820.6 Danio rerio protein_coding NOVEL, 5553 bp
CTCTCGACTGTAATTGTGAAATTAGGTTATTTTCCTTGAT
AAACCTTAAATACACTGCCGTTTTATGTAGCAAGTGAACA
TGGAGTCTGTGCGCGCAAACATACCAGGGAAGTTCATTGC
GTTGTTTTTCTCATCGCTCACGAACTCCATTGGCTTTATT
AGCACTTTACGGCATCACGATGAACGTCTCCACCAATCAC
AGCTCAGTGCGCACGATGCGCGCGCCAAGTGCAAACCCCA
ACGCCGAGAATTCGCCTTTTTTTCTAAAGGGGCGTATTTT
CCTTGCCAATTTAATTACAAACCAACATTCAATGCACACG
ATACACTCTGCAATAATGTCAGGCGCCTATTTGAAACACT
TAGGTACCCTGTCAAGGTGATAGCGTTGTGTAAACATCCA
GGATGTTTGCTTAGGAGCGTTTTTGTGGGAAGTCTCGTCA
ATGGAGGCTTGAGGAAGCCCGTCTCGCTACAGAAGAGGAC
GCTGTCGCCCCTGGATATGACCGGCATTCCCTGTCGTTAC
GAGCGATCGATAAAAGAGTACCTACGACCATTCATATTTG
ACGATTTATATAGAAGTCATCTCCAATGAGGAAGCTAAGG
AAACGAGTTGCTCAGTCCCGAGCTGGAGGCTTTGGGAGGG
GATTGGTCAGAGAAGAGGATCAGGATCAAGTTGGTCCATC
CAGCCATGTTGACATGGATGCTCTACTCTGTCCACCTTCT
CCATGCAGACTGAACTTCTCTCCAACGAGAGACACACTCA
CATATGCACAGGCTCAGCGGATGGTGGAGATCGAGCTGGA
GGGAAGACTCCACCGTATCAACATCTGCGACCAGCTCTCT
GTCGTAACAGAGGACGAGATGCTGGCTCAGGATCTGACAG
AGTGCAACAGCAACAAAGAGAACAGCGAGCAGAGGCAGGG
AAACAAGCAAGCTGCATCTAAAAGCAAAAAGAAAGATGGC
AAACACACAGCCAAAAAGAAATCAGGTGGTCAGTATGGTT
TGCAGGGGCAGGTTGCACATTTACAAGCCCCCCTGCCCAA
GCCAACATTTCGTAAATTGGACAATTTCACAGTCTCAGAT
GCTCCCCCGCTTCCAGTGGCTTATTACCGCTATATGGAGA
AGTCCGGGGAGGAGCTGGACAATGAGGCTGAGTACGACAT
GGACGAGGAGGACATGGCTTGGTTAGAGATGGTCAATCAG
AAGCGTGTGTCTGACGGCCACGCTTCGGTTCCTCCTGATA
CATTTGAGTTACTGATTGACCGTCTTGAGCGAGAATCCAT
TTTAGAGTCCCGCAGCCAAGCGTTGTCCCAGAGCACCATT
GATGAGGATGCCTACTGTTGTGTTTGCCTTGATGATGAGT
GTCTCAATAGCAACGTCATCCTGTTTTGTGACATCTGCAA
CCTCGCCGTGCACCAGGAATGTTACGGGGTGCCTTACATC
CCTGAGGGCCAGTGGCTGTGCAGGCGATGTCTGCAGTCCC
CGTCCCGACCCGTCGATTGTGTCCTCTGTCCAAACAGAGG
GGGTGCATTCAAACAAACCAGCGATGGAAGTTGGGCCCAC
GTCATCTGTGCCATATGGATCCCTGAAGTGTGCTTTGCCA
ACACTGTGTTCCTGGAGCCTGTGGAGGGAGTGAAGAACAT
TCCTCCTGCGCGGTGGAAGCTCACCTGTTACCTGTGCAAA
CAGAAAGGCAGGGGCGCGTCTATTCAGTGCCACAAAGCCA
ACTGCTACAGGGCGTTTCACGTCACCTGTGCGCAGAGAGC
GGGTCTGTATATGAAAATTGACCCAGTGCGGGAGACCGGC
ACCAATGGCACCACTTTTACTGTGAAGAAGACTGCTTATT
GCGAAAACCACTCACCTCCTGGCACGGGAACAGAGGGGTA
TGAAGATAACGGGTTGGTTGGGGGCAGGGGTAACAGAGGT
CAGAGGTCGTACACATTAGGCCCTCCGCTGCAGCAGAACC
AGAACGGGAGGAAAAAAGGGTCAGCAGCACAACAGAAGAA
AACGCAGAAGAACTCAGGCGGAGGCTCACGAAAAACAGGA
GTCCCACTTCTGCTAGTGCCGCAGATACCATCCTTTAGGC
TGAACAAGATTTGCACAGGAGTCTCTGTTGAAAGGAAGAA
TCAGTTTATGCAGAGGCTCCACAATTACTGGCTGCTAAAG
CGTCACTCTCGTAATGGCGTGCCGCTCATCCGCCGGCTCC
ATTCTCATCTGCAGGCCCAGAAGTCTGAGCAGAGAGAACC
AGATGCAAAGTTGCAGGCGGTCAGGGAAGAGCTGAAGTAT
TGGCAGAAGCTTCGCCAGGACCTGGAAAAAGCCAGACTTC
TTATTGAGCTCATACGAAAGAGGGAGAGACTCAAAAGAGA
ACAGATGAAACTTCAGCAGGCTGCACTAGAGCTTCAGCTC
ACCCCTGCGCTGGTGTTTCTGCGCGCTACACTGGAGCAGC
TGAAGGAGAAAGACACTGATCACATTTTCACCACACCAGT
CAATTTGAAGGAGGTTCCAGATTATCTTGAGTTTGTGACT
GTGCCAATGGACTTCTCTACGATGCATGACAAGCTGGAGG
CTCATAAATACTCATCAGTGGCAGACTTGGAAAACGATTT
CAATCTCATGGTATCCAACTGTCTGAGGTACAACTCCAAT
GATACAGTGTTCCACAAAGCGGCTATGCAGCTCAGAGAGG
TGGGCGGAGCCATCCTAAGACACGCCCAACACCAGGCGCT
CAGCATAGGCCTGGATCCAAGCACAGGCATGCATCTGCCA
GACAAGCCCATCCCACATAACACCACTGTCTCCTGGTGTG
ATGAAGTTGACATGCTTTTGGACCCTGACAATCGTGTGCA
CATGTGTGCTGAGGACCAGCTGAAAACACTGCTGGACAAG
CTGGATTTGGTGGCATCTATGAGGACAAGTGGAGGCCGCA
CAAAACGCATGCGCCTGCTGCGCAGAGAAATCAACAGCCT
TCGCCATAAGATCAGCCACCAGGATCGCAACTCACGACTG
CTGAATGGGAAAATTAGAGAGGAGAAGAGCAAAGATGCCA
AGAGTGAGAAGAAGATGGATTACATAACCTCAGAAGACCC
CAAGAAGTCAGCATCACAGAAAGCGCAAGAACCCGCTTGC
CCAGCCTCTTCACCTTTACCTGGCGATGCTCCACCAAATC
CACCTTTATTCTGCCTCGAGACAGGACGAACCACCACTCC
AGCACAGTCAAATAAACCTGGAAGCAGGAAACAGAGGGCA
AAAGGCAAAGACAGAAGCCTGAGAGAAAACCACAATCAGA
CCCCAAAAGAAGACGAGAACTTCCACACAAAAGAGAACGA
CAGCAGCCCTCAGGAGGACAGGGTTTGTTCTGCAAAGAAC
CAGTCTGATTCGCCCAAGATTGGTGTGGGTCGTCGCACAT
CGATCCTCTTCAAGAAAGCTAAAAATGGAGCCAGGCCGAC
TAAAGACAAGCCTGTTTTATTGCCAAATGGAGTCAGCAAA
GCTCAGAATGGTGCATCACAGGAGCAAAACACGCAAGCTA
AAGCACCATCAACCCCAAAACCAGTCTCTCCGTCCCCTCA
CCAGCTGAGATCCAGAGGACTGAGCACATGCTCGGATGGT
GAAGGCATGAAGGCCAACAGTCTGCCAGAAGAGAATGGCC
TCACAAATGGACTCAAGAGACACAACGGCAACTCATCAGA
TTCTGAAAACTCCACTCCTGCCTTCCCAACACACAGTTCA
TCTCCTCCAAAGCGCAGTCGTGGTAAACCAGCCCTCAGCA
AAGTTCCTGTAGATGAGGAGAAGAATGAAGTTACTAATAC
AAACAGTGAAGCTTCTCAAAATGATGGTGAGATGGAACCT
CTTACTTTGGTTTGGGCAAAATGTCGTGGATATCCATCGT
ACCCTGCAATGATTGTGGATCCTAAAATGCCCCAGGAAGG
AATTCTTCACAACGGCATTCCTATCCCAGTGCCACCTACT
GACGTCCTGGATCTTGGCAAACGCCGACAGGAGGAATCTG
AGGAGAAGCTCTTTCTTGTGCTGTTCTTTGACACAAAGAG
AACTTGGCAGTGGCTTCCACAGGACAAGCTCCATCACATG
GGCATTGATGACACTGTAGACAGACTGCGTTTGATGGAGG
GCAAGAAACCCAATGTGCGCAAGTCTGTGCACACGGCATA
TGACAGGGCCATGACGCACCTGAGTCACGTGCAGGAGAAC
TCTTCCTTTAACCCCTCAAATTTTATATAAAAGACTGCTA
GAAGATGGATGTCTAAACTGACTGTAAGCTGCCAGTAAAG
GTACGATCACATCATTCAGATGTTATTGGGTTTTACATAA
GTGAAAGTCAGAATTTTAAAGGGAAACTTCACCCAAAAAC
TAAAATGTCCTTACCACTTACTCACACTCAAGCAAATCCA
AACTTTAATGAATTTCTTTCTTCTGTTGAACACAAAGCCA
TATATTCAGAAGAATGTTGGAAAAAGCAGCCCTTGACATT
CAAAACAGGAACAAAAACACTGAAAGTCAATGGCTGTTTT
TCCTAATATACTTCAGCATGTCTTCATTCGTGTTCAAGAG
AAGAAAGAAACTCAAACAGGTTTGGGAGATTAGTAAATGA
TGAGAGAAGTTTAATTTTTGGGTGAACTATCCCTTTAAAC
TCGTGTCTTATATGTCCTGTTTTCTACCCTCCATTATTCA
AGGCACATCATAAATTCAAACCTGGTTTTATTAAATGGAT
AGTTTACTCAAAAATAAACATTTCCTGATAATTTACTCAA
TCCCGAGGCATTTAAGATGTATTTGACTTGTTTTCTTCTG
CCAAACCAACCATTTTTTCCTTCTAATGCATGTACACAAG
GCTCAGTGTACAATATGTTTGACATTCCAAAATCCATATT
GAGTCCACATGACCCCAGCAAATAAACACAGTTATTTTCA
TAAGGGATCTAAAAAAGGATGCACTTCTGTTTATATCACA
TTAATGAGATGGTTTAGTTCACAAAGGCCATCCAATAAGA
TCATTATTTGTTGGCATGGGGTCACGTTGAAGCTGACAAA
TTTCAGACCATCAAAACAATCAACATCAGGGCCTGTTTGC
TTACATTGGATGTTGAAAAATCCTACAAAATTATGGTTGA
AACTTCATGTACATCTTGGATGGCCTGGTGAGTGTATAAA
TAGAGCACAACAGATTCTGGTTCTAGAAACAAAAGCATTT
ATTTACCGATAAACCCTTAAAGACAGAGCTGTTGTGAATA
TTTAAATGCATATGCTATTTTTCAACTCATATTCTCATGA
ATTTGACAAACAGTTGTTTTAATAGTAGAATCTTTATAGA
AAAACTACATTCCACCAATCAGTCATGACAAACAAAGTGC
ACCAGAAGAAATATTTAGCTCTAAACACTCTTATAAAGCA
CTGCAAATGGCATCTCTGTAGATATAAAAGTATTTATTAA
AAGCTGTTAGTCGTTTGTAGATTTTTAATCGGATGTAATT
CAGAGCTTGATTAGATTGTACACTACCCAACTAAATTCTT
GTCGTGGATCCCAGTTGTAAGAGCAAGAAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations