ZFIN ID: ZDB-TSCRIPT-141209-83
Transcript Name: nfkbib-202
Previous Names: nfkbib-001, dkeyp-110c7.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022299 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022299|OTTDARG00000018394|ZDB-GENE-070705-529 nfkbib|OTTDARP00000018692 DKEYP-110C7.1-001 LG_none BX927323.5,CR753866.9 Danio rerio protein_coding NOVEL, 2024 bp
GATCTGGGGTCAGGTCGGTCTCCATTGCACTGGGCAGTGG
AAAGTCAGAAGCTAGAAACAGTGGAGCTACTATTGAGCGC
TGGTGCATTGGTAAATCAGCGGTCGTATGCAGGCCACACA
CCCTTCTACTGTGCCCTTTACAGACCCAACAAAGATATCC
AGACCCTACTCCGTGCCCATGGGGCCACTTACTCACAGGA
CGATGAAGAGGAGGAAGAATGCAGAGAGAGTGAAGAGGAG
GAGTTTGATGATGTCATCATTAATGGACAGCGAGTGCTGT
AGCTGTAAAACATGGACACTGCTCTGCCATAGACCCTTTG
AGCTCCAGCTGAATGATTGTGGTGTCTGAGTGTATCTGGT
GGAGGCTATTCTGTATGTGTGTGTCTTTGTTAATGGTACC
GTATGATGTCTGTATGCTGGTATTGGTTTAGGTTGATTGA
TTACATAGATTCTGTTTATCAGGATCAAAGTTATTTAAGC
CTGACGTCACATAAAGCCTTCTAACAATGGAGGCAGCTTT
TCATTTAATTAATTCATCAGATCATCTAGTATGTATCAGA
ATTAAAGGGATAGTTCATCTTAAGACACATATTCTGTTAT
CATTTACTTCAAACGCGTATGGAGAAGATATGTTGGGGTT
ATTTTGGAAGTGTTTTTTTGTGCGCACACAGATGTCCAAT
GTTTAAGCAACGTTCATCTAACATGTCTTACAGTAAATGT
GTGTGTTTCAAATATGAAATGGTCAGTACGTGTTCAAGAG
GTTGAGTAAATGATCCCTTTTTTTGGTTGAACTATCTCTT
TAAGAACCAAATTAGCTAGAAGACACTAAACAGCGTGTCT
ATGCTGTATGAAGGCATCATGCAGCTGTGATGCCCCCACT
ATAAGGGATGTGTTGATGTACAAGATGAAAAAAAAAGGCT
TTTTCCTTTATTTTTAAAGCTAAATTATTTGGCAGATTTA
GGTGAAGAACTATTGAAGAGAAACACGAATGGTTTTTAAT
AAACTGGCTGAATTACTATCACTGCTAAACCAACTATTTG
CTGTGTTTGAGTGGAGTGTCACTGTTTTCATTGTGACTTC
CCAACCGTCTAATGTGTGTTTACAGTGGTTGTTTTTAATT
CGCTTTTCTGTATAATACAATGGGTCTTAGGGGTCAAATA
GGATAGACAAGAAGTGGACATGAGCAATGCAGGAAAGGAT
AGTTGGTCAGGAAGCGATTTAAAGCGTTTTATGCATAACT
AAATAAATCAAATTACAATTTTAAAGAATTCTACAATAGA
AATGACAACAGATTCACAACTTTGGATTAACATGCTGAAA
TTCTTGAACGTTGTTCACATTTCAGACTTCACTAAATGCA
GTTACATGATCATATCGTCAAGAATCAACAACATTCCAAA
TTACATTAAATTTACACAATTCTTAAAGCATTTAAATTAT
ATTTGAAATGTACTACTATAATTAAAAATATATATACTGA
TTTGATTTATTTTGTTTCCAATTGTTATTAAAGTAAAGAT
TTTTAGTCACTCACATGGGGGCATTAGGGTTGTGGACATT
TTGTCACCGGTTTCAGATGTTTTATTTGGCTGAGTGTGAA
TATTTTTGGTTGATGATTGATAAAATGGACGCTCATTTGG
AAATCAGGGCTCCTGTTCTACTTGTCCTCTGTGAGTTGAC
GGAATACTGTTGTGCAGAGCAAGTTTGTAATTGTTATTTG
TCCACTGGGAATATGTCATTGATTTGACTTTATTCTTTCT
GAAGCTAAGGTCACAGTAACATCCAGGAGAGTGGGAGAAG
TAACATGTTTGGAGTAATGCAAGTCTGACCCAAGTCTTAA
AGGTTTGAGTGGTACAGTTGCTTTAAGGGAAGTTGGATTT
GTGTTTGAATCCATGTGTACAAATACATGCTGCACAGATT
TCCTCTCACCTGTACTTATTTCTGTTTACTTGGTGATTGG
TGAAATCACTGAAAAGCTCTTAGCAACCATAGAAAAGGAC
AATAAACAATAATAATGACGCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nfkbib-202 Contained in:
[BAC] CH211-46E8 (1), DKEYP-110C7 (1)

Genome Resources: Vega_Trans:OTTDART00000022299 (1),  Ensembl_Trans:ENSDART00000167418 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN326479 (1) 803 nt
GenBank:CK025606 (1) 779 nt
GenBank:CF348144 (1) 772 nt
GenBank:AW128135 (1) 589 nt
GenBank:CK400086 (1) 497 nt
GenBank:AW279995 (1) 489 nt
GenBank:BM265859 (1) 169 nt
CITATIONS (2)