Transcript

eif4ebp3l-002

ID
ZDB-TSCRIPT-141209-680
Name
eif4ebp3l-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000060488 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060488|OTTDARG00000041966|ZDB-GENE-030826-26 eif4ebp3l|no_translation eif4ebp3l-002 LG_ CU658205.6 Danio rerio protein_coding KNOWN, 909 bp
AGTAGATTTTGTGAAACAAAATAAAAGATCGTCCCAAGCA
TGTGACTAGCTTACAGTTTCCAACCCCTTCTAAATATCAT
TATAGGTGTTTAATAGAAACAGAAAATCTAAAATGCTTTT
GGGGAAGCCGATGGTGAGTAAATGGAACCAGGATCATTTA
CGACAGAAAGTTCCTCCTGGACTGCAGGAACTCTCCGATC
GCCCGGACTCCACCCTGCTGTTTGCCCCAGATTCCAGGAG
TGACCATTCCTTCACTCCACCCCGTGTCCAAATTGCAGGA
GCTCAAAGAGGAACTGGAGGAGGAGAAAGAGCTGGCAGCT
GACGACAGCCAGTTTGAGATGGACATCTGAGTGTTTGTTG
TACCTCCTGTGGAGATTTCTCTGTTTTATCAGTGGAGATG
CTGCTGTTTTTCTCTCACAGTCAGCGGACATCACAGATTC
ACCACATTTACAGGGCTTTTCATGAGCCGAACGCTGTATT
ATTAATTTCTTTCAAAGTATTTGTGAGACGTTTACCAGAA
GAAGAAACATGATTCTTTATCAGTGGCGGTGTTTAAAAAC
CTTTATTGTACATATGGTACTTTCTACTTTCTTTCTCTTA
TTTTTTTTTTAAAGAAAATGTAGCATTGTGTGTAAGCCGG
GGAAAAAAACAAACCAAAAGGCCAAATCTCTCATTTCTGA
GCAATATATCTCAGCAAACATAGATTGTTGAACGGTAAAG
GCTGAATACGTGCCAAATGAATGTCTTTTTTTTTTTACAT
ATGTTTGGTGTTTCGCCTTAAAAACAAGAAAGCACATCAG
AACATGAAATATTCACCACTGTGTGCCCTCAGGGGTTTCC
TGGTGTTTCGTTTGCCTGGATTTCCTCAGGTTTTATTATT
TTGATTTGAAATAAAGAAACAAACAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations