Transcript

n4bp3-201

ID
ZDB-TSCRIPT-141209-672
Name
n4bp3-201
Previous Names
  • n4bp3-001
  • ch73-288l11.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060463 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060463|OTTDARG00000041944|ZDB-GENE-141216-2 si:ch73-288l11.2|OTTDARP00000046728 CH73-288L11.2-001 LG_ CU694384.16 Danio rerio protein_coding NOVEL, 1435 bp
GCCCTCTGCCTTCAAACCGGTCACCCCGAAAAACTTCAGC
TCCATGCAAAACCTCTACCCATCCAAATCAGATGAGCTGG
AGTGCAGTTTACCCAACGGCATGCATCCGTCCTATAGCAA
AGCACAAGCCAAATCAATGTCCACCTCTTCATCGTCCTCC
TCTCCATCGCGTCCAGGTACAAGCACTAGTAAAGGAGTGT
TAACAGCAGCCCGCGGACTCAGCCAAGAAGAGGAAAACAC
ATCTGACTCCGGACACAACTCTATGAACAGCCTGCCGCCC
TACAAGCCACCCTTCCGCCCTCATTTGGGTCAAATCAGCG
CCTCGATGGGTCACATCAACCACATCGGCTCACTGGACCG
CACGTCTCTGGGATCTAAAGGAGCTGCGTCTACAGTCACG
GAGGTGTCCTGTCAGAGTATGGCAACTCTCAATCGTCTGC
AGTGTTACGGTAGCGAGGCGCCACCACCGTATGAACTGTC
CCAATCTCTGGAGGACGTGATTCGGGATCTGGAGGAACGA
CTTCAGGAGAAAGAGCATGAGCTGAGGCAGATGAGGAGGA
ACCTAGACGAGAGCGAAGACGCCATTGCACAGGTTTTTGA
AGGCAAACAGCGGCTCTGGGAGAAGGAAGTGACGGAGCTG
AAAAACCTGTACACCGCCAAACTGCGGCAGATATCCCAGC
AGGCTCAGCGTTCCCAGCGAAACCTGCAGCTGCAGCTGTA
TAAAGCCCAGCAGGAGCGCAACCGGCTGCAGGACGAGCTG
GAAAGCGTCAGGCTGGAGTGCCAGAAGCTGAAAAGTCAAA
GCCCAGCGGCACAAAGCCAGAACATTAATCCCCAGCTGGA
GGAAACCCAATGGGAGGTGTGCCAGAAGTCAGGTGAGATC
TCGTTACTCAAGCAGCAGCTGCGGGACTCTCAGGCCGAGG
TCACGCAGAAACTGAGCGAAATTTTCCACTTAAAGACGCA
ACTGCACGAAACACGCAATCAGATGCGGAGCAAAGACAGC
CAGATCGACTCGCTGCAGACGGCAGTGCAAGGAGCCCGGA
GGAAATGCACAATGCCAGCTTTTGAGGACACTCGATCAGA
CATGGACACGGGTGAAACTGGAGGATCCAGCGCTACAGAG
GAGCGACTCAGAGCTGAACTTCTCCTTGAAAGACGCCAGA
ATGAAGCTCAGACTTCAGCTTTTGAAAGCGAGAGGAAAAC
ATGGCAGAACGAGAAGGAGAAAGTGATTCGCTACCAGAAG
GAACTGCAGGCCAGCTATCTGGAGATGTACCATCAGAACG
AGGCCTTGGAGAGGGAACTGGCCGTGCTGAGAGGGGGCAG
GGCCAGAGTGGAGGGGGCGGGGCCTGGGGGCGGAGATGAG
GGCAGTGCTTCACATGAAACAAAGCCTCCCATTGGTCTGC
CTTGGATAGAGAGGATCGAGTCCTCTGAGATTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations