Transcript

si:ch211-241a17.7-001

ID
ZDB-TSCRIPT-141209-587
Name
si:ch211-241a17.7-001
Previous Names
  • ch211-241a17.7-001
Transcript Type
antisense
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000060149 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060149|OTTDARG00000041733|ZDB-GENE-141216-414 si:ch211-241a17.7|no_translation CH211-241A17.7-001 LG_ AL953886.9 Danio rerio antisense NOVEL, 451 bp
GCTTTGTTGTAGAGGTAGAGTCCCACTAAACCCAGTAAAG
TGGGAACCAGCGCCAGGCACAGAAGAGGCAAGATGTCATT
GATGAGCTTCTGCCATGGCGTCTGCTGGGACAGAGAGATC
ACCTCCACCTCGAACTCCAGCGTACTGTCACCTGTGAGGA
GAGACAGACAAAAGAAACTCAGAAGTGCATTGAAAGAATC
ACCACTCTAACCTGGAAAGAAAGAAAAAAAGGTTCCACAG
CCTCATACCTGTGATGACAGACCTCTTGCCCAATTCTACA
ACCAAAGGCTCGCGAGACAGAGACGTGTCTATCACCTTCC
CGTCCATTAATCGACCCTGCACAAAACAGCAAATTGATTT
TACAGGTAATATGCATTCATTATGTGTGGATGCAACAAGC
TTTGTAAATACCTGCAGACATAAGTAAAATAAGCCATCTA
ATAAAAAGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations