Transcript

apoa4a-202

ID
ZDB-TSCRIPT-141209-394
Name
apoa4a-202
Previous Names
  • apoa4a-001
  • ch73-347e22.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053545 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053545|OTTDARG00000037495|ZDB-GENE-050417-469 apoa4a|OTTDARP00000042116 CH73-347E22.2-001 LG_ CU855694.7 Danio rerio protein_coding KNOWN, 894 bp
AGAACCAGCAAATAACCATGAAAGTCCTTGTAGTATTCGT
CATCGCAGCTTTCTCTAGCTGTCATGCCAACATGATGTGG
CAGGACCAACCAATGCCCAGCATGGACCTGGTGAAAAATG
CTTTCTGGAATTACGTTTCTCAAGCGACCCTCACAGCTGA
GGAAACACTTCAGATGATCAGAAACTCAGAGCTGGGTCAA
GAAATCAATGACAGGATCTCTAAAAGCACAGATGCCATCA
ATAAATACACCCTGGCCATTCAAAGTCAGGTCACTCCTTT
GACCCAAGAACTGCTCACCAAACTGTCCCAGGAGGCCGAT
CAGCTGAAACTGAGTCTGGAGCAAGAAATCACCTCGGCAC
AGACCCAGCTCAAGCCTTATGTTGAAGAACTCAAAGTGGA
CATTGAGGAGCAGATTGAGCGGCTGAAAAAGGACGTGGCT
CCATACGCAGAGGCCCTGAACCCTGAAGCCATGAGGTTGA
CCCTGGTCCTGCGGGCTGAAGAGCTGAAGGCAAAGCTGGA
AACAAGTTTGATGGCGATGGGTCCTCAGAGCGAGGAGCTG
AAGCAGAAGCTGGAGCAGCACTTTGTGGAGTTTCAGATGA
GCATGTCTCCACTGGCTGAGAGTTTTCAGAGTCAGCTGGC
CCAGAGAAGTCAGGAGCTCCAGAAGAATCTGGCTCCCTAT
TCTGAAGAGCTGAGCAAACTAGATCCGCTCGCTCAGGATC
TGAAGGACCAGCTGACTGCCCTCTGGGAGTCCTTCGCCAA
GGATAAACAGTCGTGAAAGACTCTAGAGACTTTTAGATAT
GCGTAATTTATGTTATTTTTGGATTTAATATATATTTTTG
TCATTCATGCATGTTTTTACCAAAAAATTGTGAAATAAAA
AAACAGTAAGCACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations