header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-376
Transcript Name: p2ry1-202
Previous Names: p2ry1-001, dkey-151j17.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053144 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053144|OTTDARG00000037285|ZDB-GENE-121004-2 p2ry1|OTTDARP00000041797 DKEY-151J17.5-001 LG_ CU640433.12 Danio rerio protein_coding NOVEL, 1176 bp
AGTGCTGTACAGCGGCAGCAGATCTCCATCAATGCGGTGG
CGGATCCCGCTGAATGCGCCCGGGGAAGCGCGCTGATCGG
CGGCTCTGCTGATCTGACCTCTGACACCATGACAGCGGAG
TTTAATAACCTGACGTCGCTCATCAGTAACGCGACCGACT
CGCCCAACCAAACCTCAGGATGTTCGCTCACAAAAACCGG
CTTCCAGTTCTACTACCTGCCCACGGTCTACATCCTGGTG
TTCCTGACCGGCTTCATCGGCAACAGTCTGGCCATATGGA
TGTTCGTCTGCCACATGAGACCCTGGAGCAGCATCTCCGT
CTACATGTTCAATCTGGCGCTGGCCGACTTCTGTTACGTG
CTCTCGCTGCCCTTCCTCATCTACTACTACTTCAACAAGA
CCGACTGGATCTTCGGGGACGTCCTGTGCAGGCTGCAGAG
ATTCATCTTCCATGTTAATCTCTACGGGAGCATCTTGTTT
CTAACATGCATCAGCGTGCACCGATATTCCGGCGTCGTGC
ATCCGCTGAAATCGTTGGGACGGCTGAAAAAGAAGAACGC
GGTGCGCACTGTCGCCCTCGTGTGGTTCATCGTGGTAGCA
GGAATTGCGCCGATTCTCTACTACTCCCGTACGAGTCGTA
AAAAAGAACACACCACATGCTACGACACCACGAGTCAAGA
CGAGCTGCCTGGATATTTCATTTACAGCATGTGCTTGACG
GTGTTCGGCTTCTGCATCCCCTTCATCATCATCCTCAGCT
GTTACGGAGGAATCGTCAAGGCTTTAATATGTAATGATAT
GGACAATGCTCCGCTTAGGAAGAAGTCCATCTATCTGGTG
ATCATCGTGCTGACCGTATTCGCCGTCTCCTATCTGCCGT
TCCACGTCATGAAGAACCTGAACATGAGAGCGCGGCTGTA
CTTCCAGAGTCCCGATATGTGTGCATTTAATGACCGCGTC
TACGCCACATATCAGGTGACCCGCGGCCTGGCCAGCCTCA
ACAGCTGTGTCGACCCAATACTGTACTTTCTGGCCGGCGA
TACATTTCGGAGGAGACTTTCCAGAGCCACCAAGAAGTCC
TCCAGGAAAGGAGATCATCCTCTGCAGTCTAAGAGTGAGG
AGACGGCGCTCAACAGCCTGCCGGAGTCAGTGCAGAACGG
TGAAAACCGCATGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
p2ry1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000053144 (1),  Ensembl_Trans:ENSDART00000167725 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB779847 (1) 286 bp
CITATIONS (2)