header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-3491
Transcript Name: fabp1b.1-201
Previous Name: ottdart00000061722

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061722 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061722|OTTDARG00000042720|ZDB-GENE-050522-96 fabp1b.1|OTTDARP00000048273 fabp1b.1-001 LG_ CU683892.9 Danio rerio protein_coding KNOWN, 499 bp
GTATTAAAGCGTCTGTCGGACCCTCAGGGTCACTCTGTAT
TCAGCTCTCATCATGTCGTTCACTGGGAAATATCAGCTGG
AGAGTCAAGAGGGCTTCGTGGAGTTCATGAAGGCCGTCGG
TCTTCCTGACGACATGATTGAGAAAGGCAAAGACATCAAG
AGTGTGTCTGAGATCGAGGAGAACGGAAACCAGTTTAAAG
TGACCGTCACGACCGGATCAAAAGTGCTGACCAACAGCTT
CACCATCGGGCAGGAGGCCGACATTGAGACGCTGACCGGA
GAGAGAGTCAAGACTATTGTGAACAGAGAGGGAAATAAGC
TGAAGGTGGTGCTGAACAGAATCACATCCATCACAGAGCT
GGTGGACGCAAACACACTGGTCAACACTCTGACGCTCGGC
GGCCTCGTCTACAAGCGCATCAGCAAACGTGTGGCGTAAA
AACATGAGCTGAGCAAACACACGCAAGACTTTTTATACAT
TAAAGTGTTCTCAATCTCA

fabp1b.1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fabp1b.1-201 499
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fabp1b.1-201 Contained in:
[Fosmid] ZFOS-335G10 (1)
OTHER fabp1b.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061722 (1)
  • Ensembl_Trans:ENSDART00000149528 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ062096 (1) 538bp
    GenBank:CN013663 (1) 515bp
    GenBank:DQ474062 (1) 507bp
    GenBank:EH606424 (1) 496bp
    CITATIONS (2)