ZFIN ID: ZDB-TSCRIPT-141209-3485
Transcript Name: susd1-202
Previous Names: susd1-001, ch73-247j11.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061704 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061704|OTTDARG00000042706|ZDB-GENE-141219-16 si:ch73-247j11.2|OTTDARP00000048259 CH73-247J11.2-001 LG_ CU929094.7 Danio rerio protein_coding KNOWN, 3483 bp
TCATTGCCAAACTGCATCAGCTCGTCATACACTATAGAGT
TGGCACTGGATCTGTTGTGAATTTGTACTCCATTTATTAT
TACGATCTCATCAAGAATATGATGGTATTGTTGTTCTTAT
GAAATGTAACTGTAATATGACATTCATATGAAGAGATCTT
AATTTTGTTTTATTAAAAGGAGGTGTTTTGGAGCAATGGA
AATATGTAGAGGAATTCCGGCTGACAAGAAAGAGAAGAGG
AGATGAAGAGCTGACCTCAACTAACCATTCAGCACTATCA
CCACACTTCAGAATGGAGGAGGAGGGTCTGTAAGGGGAAA
TGAGGAGAAATGCGGAGCAGAGCTGCAGTTTTTTGAGTTC
ACAGGAACCGAGGGGGAGAAAAACAGAGATGACAGTCGTA
AAAGTGGCCTTGTGCTTCCTGATGATCCTAAACATCTTTA
AAGATATTAGAGCGAATGCAGACATGGTGGATGTTTGTGC
CTCTTGTCATCGAAACGCCACCTGTGATGATAAAACTGAC
GGATCAGGAGGGAAAGTCTGCAACTGCATGTATGGATTTG
TCGGCAATGGGAGGACTTATTGCCAAGATAAAGATGAATG
TCAGCTGGGTAAAATCTGTGGCGATCACACCAAATGCCAC
AACACACACGGCAGCTACTTCTGCACCTGTCTCGCAGGGT
ACAGCCCGTCTAATCAAATGAACACATTCATCCCCAATGA
TGGGACGTACTGCCATGATATTGATGAGTGCGTTGTTCAG
GGGGTCTGTGGAGAAGGAGGACTCTGTCAGAACACAGAAG
GAGATTTTACCTGCTCCTGTCAGACGGGTTATAAAGTCCA
GGATGGATCTGAACCCTTTAATCCAAACCGGGACGCAGCT
CACTGCAAGGTGATTGACTGTGGGTCTCCTCCAGCCGTCC
TGCATGCTGATCTGCTCTCCTCCACAGTCAACACACACTA
CAGTACTGAGCTCCAGTACGGCTGCAGAGACGGCTTTCAG
TGGAGGAGAGGACTCAACTCATCTGTTTGCGGCCTGGATG
GAAAATGGCAGGGGCCCAGTCTGGACTGTGAAGAAGTGGA
CTGTGGAGAGCCTCATATTTTTCCTCAGTCAGAACTAATG
TGGAATCACACCTCTCGGATGGGATCTTTGGTGCTGTATG
TGTGTAAGCCACAGTTTTATAATCGTGGACTTGAAAATGT
GTCAGTGTGTTCTGCTCGGGGCACGTGGAGCCGTGCTGAC
TTCCAGTGTGCAGAGATAGAATGCGGTTCTCCTGCTGTCC
TGCCGCACTCTGTGTTATTGTGGAGCGGTGTCAGTAAGAT
CGGTTCTGAAGCTCTGTATGACTGTGATGTCGGATATCAC
AGTTCGGATACAGAAAATAAGTCTGTGTGTAAATCAGACG
GTCAGTGGAGTAAGCCAGACTACTCTTGTGAAGAGATTGT
GTGTGGCGAGCCTCATATTCTGCCACTCACTGTGCAGATA
TGGGATGGCAGAGTCACGTTTAACAGCACTGTAACATATC
AATGCCAACACGGTTACTATCCTAAACAAGGACAAAATAT
ATCTGTGTGTGCTGAGAACGGTTACTGGACAAAAGCTACT
CTGTTGTGTGAAGAGGTGCACTGTGGATTACCGCCTTCTC
TCCCGCTCGCGGTTATGATATGGAGAGGAGACACTAAGGT
TGGATCTAGTGTGTCTTATAAGTGCATTGAGGGATTTCGT
AATGTTAGGAAAGAAGAAACATCAGTTTGTGATTCAGAGG
GAATCTGGAGTCTGCCTGATTTTCTCTGTCAAGAAGTAGA
CTGTGGCGTCCCCGTCTCTCTGCCTCATTCAGTTGTGTTG
TGGAATAACAGCTCCAGTCTGGGCTCCGTGGCCCTCTATG
TGTGTCAAGCTGGATTTCACACTGTGGGTGAAGGAAACGT
GTCTCTGTGTCGTTCAGACGCAAAATGGAGCAAACTTAAC
ATGAGATGCGAAGAGATCAACTGTGGGCCTCCTCCAGAAT
TCCCACACACAGATTTAGACTGGAACAAAGCATCTACACT
GGGAAGTGTGGTTCAGTATAAATGTAAATCTGGACTCAAA
CAGGAGGGTGACAAAAACATGACGATGTGCAAATCAGACG
GAACGTGGGAAAAAGTGTCTGTAACGTGTTCAGCACACTG
TGGCCCTGCACCAGAGCTGCCGCACACTGAGGTATTATGG
GACAACAGCACTGCAGTCGTTCACCGCTGTGTTAAAGGAC
ACTACAGACACGCCGGAAGTGACATTTCAAAATGTGACAT
TACTGGAGAATGGCAGGTTGCCACTCTCCATTGCAGAGAG
CTGAAGCTGACAATAAATGATCTGGTGGTGTTTAATGAAA
GATGTCTACGCTGGAATGCAGAGAATGAAGGGTATAGGGA
GAAATACACAGTGACGTTTGTTGGATTGCGAGACTTTGAG
CATTTCTTCAGTGACAGGAGAAAGATGTTGTTTACCTCCT
CTGCAGTTTGGCCTGTTCTCTGCTTAAATCTCCTGCCAGC
AACAAACTACACCATAACAATCACGGCCGAGTCCACACGA
GCCACGGCTACAGTTACAGCAAACACTAGCATACCAGTTC
CCCCAACACCAGAAATCAAATACAGTGAAGTAGAGGCTTC
ATCGCCCACTCTCAGACTGAGAAGATCCACCAACACACTC
GACTCAATATGCATGTACGAGGTGTTTGTGTTGCCGGTGG
AGGGTGTGATGCTGTTTGACTGCAGCTCCTCTTTAAGTCG
GCACTTTTCAACACAGCAGGGCTGTGATGGCGGATACGTC
ACGGCTCAGATTCAGCTTCGAGATCTGAACGCAGAAATGA
ACTTCACTGTGGGCGATCAGCAGCTCTACGGAGACTTCTT
CAACGCTCCTCTGCAGAACGGAAAAGACTATTTCATTATC
CTGCGCACCGTGTGTCAGTGGGGAAAGTCCAGAACACAGT
CCTGCATAATCTGGGCTAAAACTAGAGGGACACACTACAT
CATGAAGATATCTGCTTTGGTAACTGTTGGATCGATTAGT
GCTGTCGGCTCAGTCATTATTGTGGGATACTGGTACAGCT
GGTGAGATTGCATTGTGTTGTATTTATATTTTGACAGGAC
ACTGCAGGTAAAAGAGTTTGGGCTTTTCATAAAGTATTTT
CTTACCACTGAACTTTTGAAAGTTTATAATTAAAAGAAAT
GTGCTATTCTTAATGTAATAAGTCAGTTTAAGCAAGTGTT
GTGATAACTATTAGGTTTTTTTAAAATACTAATTCACCTG
CAGAGTCTCGCCTTAATATATGTGATCCAAATATTGATGC
ACTTCTTTTAAGCACATTCAAATGATTATTATTAATAATA
TTATACTTTTTTTTTTACAGGTACTGTAAAAAGTCCAGTC
CTAGGCATTTTTCTCAAGTTTTATAAAAACATCCTGACAT
ACTGATACTTTGTTTTTAAATAAAGCTGATTGTCTTGTCA
TAA

susd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA susd1-202 3483
susd1-203 (1)    Ensembl 853
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
susd1-202 Contained in:
[BAC] CH73-247J11 (1)

Genome Resources: Vega_Trans:OTTDART00000061704 (1),  Ensembl_Trans:ENSDART00000081772 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK400921 (1) 844 nt
GenBank:EB986105 (1) 482 nt
CITATIONS (2)