Transcript

si:ch211-276a23.5-201

ID
ZDB-TSCRIPT-141209-3472
Name
si:ch211-276a23.5-201
Previous Names
  • ch211-276a23.5-001
  • si:ch211-276a23.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061663 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061663|OTTDARG00000042673|ZDB-GENE-141215-4 si:ch211-276a23.5|OTTDARP00000048228 CH211-276A23.5-001 LG_none CR848709.18,CU019634.3,BX005410.7 Danio rerio protein_coding NOVEL, 3117 bp
ATTCTGACTCTGCGGCCATGGGGAAAGGCTTTTATATCAG
TAAACCTCTTGCTTTTGTACTACTTGCGTTGGCCGTTGGG
TCCCTGCTCACCATCCTTGGCTTATCATTGATTTACGCTC
AAGAAAAACGAAGAAATGAGGAAAATATGGTGAACAATAC
GGTGACGACTTTAGCACCCTACAGCACTTCAATACCATCA
AATGAGCCCTGGGACAAATACAGACTGCCTGATACGCTTC
TTCCTGAATACTACAACATCACGCTATGGCCTAGGTTGAC
GAAGGATGATTTGGGAATGTATATTTTTACTGGTAAATCT
GGAGTGGCGTTTTTGTGTGTGAAGGAGACCGACCTGATCC
TTATTCATTCCAGTAACCTCAACTTCAGTTTGACGGCGGA
GAAGCACCATGCAGAGTTGATGGGATTGGGTGGCACGAGA
GCTCCGGTCATACTGAAGACCTGGTTTCAAGACCAAACGG
AGTTCATGGTGATTCAGCTCAGGGAGAATCTACAAGTAGG
AAAGTCCTATTGGCTCTATACTGAATTTCAAGGAGAGCTG
GCGGATGACCTGGGAGGATTTTACAGGAGTGAATATGTTG
AAAATGGGGTGGAAAAAGTTGTCGCCACCACACAGATGCA
GCCCACTGCTGCCAGGACTGCTTTTCCTTGCTTCGATGAG
CCCTCAATGAAAGCCGTTTTTCATCTGACTCTCATTCACC
CTCCTGGAACTGTGGCTCTGGCTAACGGCATGGAGACAGG
CACTGAAAACATCACAATAGAAAATCAACAGGTTTTACAG
ACCAGATTTGAGCCGACTGAAAAAATGTCCACATACCTGC
TGGCCTTCGTCATCAGTGAATTCCCCAGCATACAATCCCC
ATTAGGGGCTAACAAAATTCTGGTCAGAATTTGGGGACGT
AGAGAAGCCATCGAGAACGGAGAGGGAGATTACGCCCTAA
ATGTTACATTCCCGGTTTTGAAGTATTTAGAAAGCTATTA
CAACACCACATACCCCCTGTCCAAATCAGACCAAATCGCT
CTGCCTGATTTTTCCGCTGGAGCAATGGAGAACTGGGGTC
TGGTCACATACAGAGAAACTTTTCTTTTCTACGAGCCGAA
AGTATCCTCTCATGAAGATAAAGAAGGGGTGATCACTGTA
ATCTCACATGAACTTGCCCACATGTGGTTTGGGAACCTTG
TGACCATGAGATGGTGGAATGATCTTTGGCTCAATGAAGG
CTTTGCAAGTTATGTTTCATATCTCGCCGCTGATTATGCT
GAGCCTACATGGAATATTAAAGAGCTGATGGTCCTGCAGC
AGGTTTACCGGGCGTTTACAGTCGATGCTCTTGTGTCCTC
GCACCCCCTGTCTTCACGAGAAGACGCAGTCAACACCCCG
CAGCAAATCGAAGAGCTTTTTGATGCCGTAACATACAGCA
AGGGGGCTGCAGTGCTGAGAATGCTGTCTGAGTTTCTGTC
CGAGTCCGTCTTCGCTAAAGGACTTCATAACTATTTGCAA
GAGCATGCTTACAGCAACACAGTGTACACAGATCTCTGGA
AAAAACTGCAGGAAGTTGCAGACTCTGATGGAAACGTTCA
TCTCCCAGCCTCAATAGAGGAAATAATGAATCGCTGGATT
CTTCAGGCGGGCTTCCCTGTTGTAACTATTGACACTCATA
CAGGAAGTATCTCTCAGCAGCACTTCCTGATTGACCCAGA
GGCAGTAGTTAACAAACCATCTGACTACAATTACGAGTGG
TTTGTGCCCATCACGTGGATGAAGAATGGCAGAAACATGG
GCCAGCACTGGCTCCTTAATAAAAGCACTTCATATGAGCT
CATGAAGACAGAGACAAACTGGATACTGGCCAACCTGAAT
GTCACGGGATACTACAGAGTTAATTATAATTCCCAGAACT
GGGAACGTCTCATTAAACAACTGACTTCACATCATCAAGC
TATTCCAGTTCTCAACAGGGGTCAGATTATTGATGATGCA
TTTACTTTGGCGAGAGCAAATATTCTCAACATAACCATGG
CTCTGAGAACAACCCAGTATCTCTCAAACGAGAAGGAGTA
CATACCGTGGGAATCTGCCATTAGAAATCTGGAATACTTT
TTCCTCATGTTTGACCGAACAGAAGTCCGTGGACCTTTGG
AGGCTTACCTGCGGAGAAAGGTGGAACCACTTTTTCACTA
CTTCAAAGTCATCACATCAAACTGGACTCGGAAACCTACG
AGACACATGGACCAATACAACCAGTTGAATGCGATCACAA
TGGCCTGCAAAACTGGGGTCAAAGCATGTTCAGAGCTCAC
CAGCATGTGGTACAGACAATGGATGAAGGACCCGAACGTC
AACCCAGTTCCTTCAGATCTGAAGACTGTTGTCTACTGTA
ATGCCATTGCTGCTGGCGGTGTCGAAGAATGGGATTTTGG
ATGGGCGATGTTCAAGAACAGCACTGTAGCTGCAGAGGCT
GAGAAACTGATGTATGGTCTGTCCTGCACTAAAGAGCCCT
GGCTGTTGAACAGGTACCTGCATTACGCGATTGATCCAAA
CCTAATCAGGAAGCAGGACGTCACCTATCCCATTGTGTAT
ATTGCCAGCAATGTAATTGGCCAGCCGTTGGCTTGGGACT
TTTTCAGAGCCAAATGGCAACTTATGACAACAGAATTTAG
AGTCCTGATCCTGGGCATCGTAAAAACCTTTTCCACAGAA
TTTCAACTGCAACAGTTACAACGATTCCAAGAAGAAGTTG
CAGAGAGTGACGTTAGTTTGGGCACACATGCAATAGAACA
GGCCATCGAGCAAACCAAAGCCAACGTTAAATGGGTTTCT
GAAAACAAAGTGCAAGTGATGGACTGGCTGATCCAACAGT
CAGCCTGAATGCCCATTCCAAGCAGTTTTGCTATTAAATA
TTTTCAGATTTACATGACTATTTTATAGATTAATATAATT
TTGAAAAATAATTGCACAGAAAATTTCTCACCAATATATT
TTGCAGTATTTTATGACTTGCCTACTGTCACTCAACGTGT
ATATGTATATATGTGTGTATGCTTTCAAATATTTAACATT
AAACAAATAAAATTTTATGTTTATCATCACTAATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations