Transcript

lsg1-202

ID
ZDB-TSCRIPT-141209-3415
Name
lsg1-202
Previous Names
  • lsg1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061479 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061479|OTTDARG00000042553|ZDB-GENE-030131-2184 lsg1|OTTDARP00000048030 lsg1-001 LG_ CU694233.6 Danio rerio protein_coding NOVEL, 2522 bp
ATTTGAACGCGACACCACCGAACAAAACAAAAGTCTGGCC
AAGATTTCAATTTTCGCCCAATTCTCAGTCTATTCTACTA
TTATTTAAATAAATATTCACTGTACTAAAACGACATGAAC
ATAAAGAACACAATCAACAATTGTCATCTCTTCTAAACAT
TCGCGAAGGAGTGGTCCCTCTCGTAGATCATTCCGTGTCA
CTTCCTTCCTCTGCCATAACAAACATATCACACGCGTGAA
GGTTTATCCACTCGAATGTCCACGAACAACTCACTGTCAC
GCGTTTATATCGCCGTTTAACCGTGTAAAGAAGTTTAAAA
TGGGGAAGAAGAAGACTCGTGGAGAGGGTTCAGGGTTGGG
GAGAGCTTTAATAAAGGAGAGACTGAACGCAGGCCGCGGA
TACAGGAGAAACGACACATGGCTTCACACCAGCGAGCTGA
ATGATGGATATGATTGGGGTCGGCTCAACCTGCAGTCTGT
CACTGAGCAGAGCTCCCTGGACGACTTTCTGGCCACAGCC
GAACTTGCTGGAACTGAATTTGTTGCAGAGAAGCTCAATA
TAAAGTTTGTCCCAGCTGAAGCAAGAGCTGGCTTGCTTTC
CTCTGAGGAGTCCAGGCGGCTAAAGAAACTCCATGAGGAA
AACAAACAGCTTCTGCGAATCCCCCGAAGACCTCCTTGGG
ATGAGAGCACAAGTCCTGAAGTTCTACAGCAAACTGAGAA
AGACAGTTTCCTCACATGGAGAAGAGATCTGGCTCGGTTG
GAAGAGGAGCAGAAGTTGATTCTCACCCCTTTTGAGAGAA
ATCTCGATTTTTGGAGGCAACTGTGGAGAGTTATTGAGAG
AAGTGATGTTGTGGTTCAGATCGTTGATGCCAGAAACCCT
CTTCTGTTCCGATGTCCTGATCTTGAAAAATATGTAAAAG
AGGTGTCTGTTCACAAAGTAAACATGCTTCTATTGAACAA
AGCTGATCTGCTGACTAGAGAACAACGGAGAGCCTGGGCT
CGATATTTTCAGAAAGAGGGCATCAGAGCTGTGTTCTGGT
CTGCTTTGGCTGAGGCACAACGACTCGAGGCAGAGGAGAG
GGGAGAAGATGCGATGGACCAGGAAGATCAGAGTGATACA
GAAGAGGAAACAGCCTCCAAAAATGCCACAGATCATCATG
AGGAAAATAGCTCTTCACCAAATGAAGAGAAAGATGAGAA
TGAGCAAGATGAAGAAGAGGAAGGTGAAGATGAAAGAATC
TGTGTTGATGAGAGCGAATGGCAAACATGCTCTGAGGAAT
CAGGAGATGAAGATCACGCTGAGGAGAACCCAGAATCCAC
AGCGACTTCATCTTTCTATAACTCCAGCCGCTTGTTACGC
AAAAATGAGCTGCTGGAAATGTTTAAGTCTGTGCATTCTG
GACCGACATGCAAAGATGGACAAATCACAGTTGGACTGGT
TGGATATCCAAATGTTGGGAAAAGCTCCACCATCAACACC
ATCTTTAGGAATAAAAAAGTCTCAGTTTCGGCAACACCTG
GACACACAAAGCACTTTCAGACTCTGTTTGTTGAACCCGG
TCTTTGCCTGTGTGATTGTCCTGGACTGGTCATGCCTTCA
TTTGTGTCCACCAAAGCTGAGATGATCTGCAGCGGGATCC
TACCCATCGATCAGATGAGAGATCACGTGCCAGCCATCTC
TTTGGTATGTCAGAATATCCCTCGAAATGTGCTGGAGGGG
ACTTACGGAATCAACATCATCAGACCGAGGGAGGACGAGG
ACCCTGATCGGCCGCCTACCTATGAGGAGCTGCTTATGGC
ATACGGATATATGAGAGGCTTTATGACAGCACACGGACAG
CCAGACCAATCAAGATCTGCTCGATATGTTTTAAAAGACT
ATGTCAGTGGCAAACTCCTCTACTGCCATCCTCCACCTCA
CATCGATCCTGAAGACTTCCAGCCTCAGCACGCCAAGTTT
GCCATGCGGATAACAGAAGCCGAACAGATCGATGGCAGTG
GTGGCAAACCATCAAAAGTGAAACGCATAGAAAACACAGT
GGATAAACAGTTTTTTCATCAAGCAAATGTGCGGGCACTG
ACCAAGGGTGTACAGATGGTGATGGGTTACAAACCTGGAA
GTGGTCCTGTTGAGGCTGGAAAAGCAAACACAGAACAACA
AGCCGGAAAGCCCTGGAAAAAACATGGGAACCGGAACAAG
AAGGAGAAAGTGAGAAGACTCAACAAACATCTGGATGCCT
GATTTCTTACATGATTGGTTCACAAGTGCAATTCATGTTA
GTAGATGTTTGGATTTGATACATCCTTTAAGGCAAAGACA
TTTCAAATTTCATACCTGGATGTGACTAATAAGTGCTGCT
GGACATTCCTCTTTGTTTGAAATGTCATCACTTGTAATTA
TAATACACTCACTCTATTTTATCATTGTACGGGATGATGA
GATGAATGGATACATTGGTAGACACTGATACATGCAGTTC
TCCTCATAATAGCAATAAAAGTCATTTTATTCTTTACTAA
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations