ZFIN ID: ZDB-TSCRIPT-141209-3395
Transcript Name: limch1b-205
Previous Name: limch1b-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061417 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061417|OTTDARG00000042070|ZDB-GENE-030131-9210 limch1b|OTTDARP00000047791 limch1b-005 LG_none CU075768.4,BX248304.9,CT963086.7 Danio rerio protein_coding KNOWN, 613 bp
AGTGACTCTCTACACGACGTGATTCAAATGGAGATTTCTG
CACAGGTCAGTGAACTAACAGCTGAGATCCCACAGAAATC
AACAAATGAATCTGAGTCATCCAGACCCGAATCATACAGA
ACCAAAGCAGATATGGCTGAGAAGGCTCATGAAAATGTCC
CTCCCTCAGTGCTGAATCTGGTGAATCGGGGTGAACACTT
TTCTTGGGACCCTGAGGAAGAGCGCAATCGTCAGGAGAGG
TGGCAGAAAGAGCAGGAACGCATGCTTCAGGAAAAGTATC
GACGTGAGCAGGAGAAGCTAAAGCAGGAGTGGGAGCAGGC
GCAGAAGGAGGTGGAGGAGGAGGAGAGACGCTACCATGAG
GAGGAGCAGAAGATTCTGGAAGAGACTGTGACCCCTTTGA
CCCCACACTCACCAATTGCACCGCCAGTCCTTCCCAAAAC
TCAAAGCACTTTACACTCCCAGCCCGATCGGGAATATAAG
CAGGGGCCAGTGGAGAAGCAGCCGAGTTCTGAGAACTGCA
GACAAAGGGAAAACGGCATCAGTGAAGCAGCACAAAGAAA
GACGGAGAGTTTACAGATGACAGTAAGTTCTCCCCTCCAA
AGCTGTGGGTCAG

limch1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA limch1b-202 (1)    Ensembl 5500
limch1b-203 (1)    Ensembl 604
limch1b-204 (1)    Ensembl 806
limch1b-205 613
ncRNA limch1b-004 (1)    Ensembl 571
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
limch1b-205 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061417 (1),  Ensembl_Trans:ENSDART00000170208 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB905165 (1) 613 bp
CITATIONS (2)