Transcript

gucy1b2-201

ID
ZDB-TSCRIPT-141209-3373
Name
gucy1b2-201
Previous Names
  • gucy1b2-001
  • ch211-218g23.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061333 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061333|OTTDARG00000042477|ZDB-GENE-130530-664 gucy1b2|OTTDARP00000047484 CH211-218G23.5-001 LG_ CR352256.11 Danio rerio protein_coding NOVEL, 2343 bp
GTTTGGGAGAGTATACAGAATACAACTTTGGAATTACAGC
AGATGGTTTGGAAAAATGTACGGCTTTATTAATACTTGTC
TGAAGTCACTGGTGATTGAAAGGTTTGGAGAAGAGACATG
GGAAAACTTAAGATTAATGGCTGGGGTCCAGGAAACCTTC
ATGACATATGAAATCTACGATGATATCATCACCCTTCGTT
TAGTCCAAGAGGCTTGCAAAATGCTGGATGTCTCCTCCGA
GGTGGTTCTGAAGTTGTTTGGAGAGTACTTTTTCAGCTTT
TGTAAGATGTCGGGATACGACACTATGCTGCGAACGCTTG
GAGGAAATCTGGTGGAATTCATCGAAAATCTTGATGCTCT
GCACAGCTATTTGGCATTGTCTTATGAGGCCATGAATGCT
CCATCCTTTCGGGTGGAGCGGATGGACGATGGCCGAATTC
TCCTCCATTACTACTCTGACAGAAAAGGACTTTATCACAT
TGTGCCAGGTATTATCGAGGCTGTGGCAAAGGATTTCTTT
GACAGTGAGGTTACGATGACCATACTGAATCAATCAGAAG
AGGATGAGCGCACCGGAAAAAAGGAACATGTTGTTTTCCA
CATGGTGCAGAAGGAAAAGGTCACCAAAAGAAAGGCCCAA
ACAAGACAGAACAACAGTGAGGAGGAAATACTAGAGGTGA
AAAAAGACAAGGAGGAGACAATGAGGAGGATGAAGGCCAG
GTATGCAAACCTGCAGCTGTGTCCAAGGAAACGATCTCCA
TGGGAGCTTGTGAGAAGCATTGTCATGCTGGGCCAAGGCA
ATCTGCGGCAGTCATTCACTCCCAGCTACCCAAAAACACT
GTGGATTGAAGAGCAGGCCTTCTGTAATGCTTTTCCCTTT
CACATAGTTTTCGATAGTGACCTGGTGGTGAAGCACACAG
GTGTCAACATTCAGAAGTTTGTTCCTGGACTGCAGACAGC
AGGAATCCGACTGGATGAGTACTTTACAATTGTTCACCCA
GAGGTCATCTTCAACATCCAGAGCATCAAGAAGTTCATTA
ACAGCCAATTTGTGCTAAAAACCAGGAGGGAAATGTTACC
AGAGGTCCAGCAAAACCAACCCACTCTCAAATTGAGAGGA
CAGATGATGTGGATGGAGTCGCTGAACTGCATGATCTATC
TGTGCTCTCCAAAGCTACGAAGTCTCCAGGAGCTAGAGGA
ACGGGGTCTTCATCTGGCTGACATCGCTCAGCATGACACC
ACAAGAGATCTGATCCTGCTCAACCAGCAGAGGCTGGCTG
AAATTGAGCTTTCCAATCAGCTGGAAAGAAAGAAGGAGGA
GTTGAGGATCCTCTCGCGCAACCTGGAGATCGAGAAGCAG
AAATCAGAAAAGCTCCTCTATGCCATGCTGCCGACGCATG
TTGCCAACCAGCTTAAAGAGGGCAAAAGAGTGGAAGCGGG
TGAGTTCAAAGTGTGCACCATCCTCTTCAGTGATGTGGTC
ACATTCACTAACATCTGTGCAGCCTGCGAACCCATTCAGA
TAGTCAACATGCTCAACGCCATGTACTCCAGATTTGATCG
TCTTACAAGCATCCATAATGTCTATAAGGTGGAGACAATA
GGTGATGCTTACATGGTGGTTGGTGGTGTGCCTGTTCCTA
CAAACACACACGCAGAACGGGTGGCAAACTTTGCCCTCGG
TATGAGAATTGCTGCGAGAGAAGTAACCAACCCTATCACA
GGACAGCCCATACAGATTCGTGTTGGCCTGCACACCGGTC
CAGTTTTGGCTGGCGTTGTAGGTGAGAAGATGCCACGATA
TTGTTTATTTGGAGACACGGTAAATACAGCCTCTCGGATG
GAGAGCCACGGGGTCCCAGATCACATACATGTGAGCCCCT
TCACTTTCAGTGTGATAAAAGACAAAGGAATCTTTGAGAT
GGCGGAGAGGGGTGAGATCGAGGTGAAAGGCAAAGGCCTG
ATGAGAACATACTTCCTGCTGAAGAACCTCCAGAAGAGCG
ACGAACAGATCATGGGCTTGGTTGATGGAGAGATGTGTGT
GTACCAGGAAGACCTGGAGGAGGAGACGGATGACCTGAAG
GAAGTGAGTCCCGAAGACATGAATGCTGTGCTGAAAGTTG
AAGAGGACGCACATAAGGAAGTGGCTGAGAATGGGAATAA
TCACACATCACCACCATCCCCATCATCTCTCCACTCAGAC
AAAAGCTCCTCCGATCATTTGATTCAGTTCGACATCACGC
CAGCGTACGACAGCCCGAATGACTTCAAACATCTACACAA
TGGCCATCACTCAGATGGCATTAACACAAAGTTCTGCTCC
ATACTTTAGTCCTGTGTTTCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations