Transcript

cadpsa-202

ID
ZDB-TSCRIPT-141209-3318
Name
cadpsa-202
Previous Names
  • ottdart00000061145
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061145 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061145|OTTDARG00000042369|ZDB-GENE-030616-525 cadpsa|OTTDARP00000047881 cadpsa-001 LG_none CU914143.13,CR407702.15,BX276115.12 Danio rerio protein_coding KNOWN, 4595 bp
CTCCGCGCGCGCGCGCCGCTCATTGTCAGTACCGTTCGCT
GCTAAATTTAAAAGACTGCCGGAGGAAACCAGAAAACATC
AGCTGCCAATCGTTTCACGACCCTCCCAGTACTATCTCCC
TTCAACCCGCTATGGTAAACCGAGAGTTAAACACGTAAGC
AGCAACAATTTAATTCGGTGGAAGACTACTGGCTGTTGGA
GCAGCTTTTTTCACTCGCAGTGAGGGGAAGCGAGAACTTG
CGTTGAAATGTTGGACCCGTCATCCAGCGAGGAGGAGGCG
GATGAGGTTGTGGAAGAAGAGCGAAAAGTGGTGGCGGCGC
CCAAGGCTGGTGGTCCTCGGGTGTCTTCAAGCCGGACCAG
CGAAAGCTCTGGTGGGCTGCAGCCGAGCCGAAGCACCAAT
GCCCGGCCGACGAGCCCCAGTCCCTCAGTGGCGGTCGAGA
AGGAAAAGGATGATTTAGAAAAGATGCAGAGGGAGGAAGA
GGAGAGGAAGAAGAGGCTCCAGCTGTACGTCTTTGTGATG
CGGTGTATTGCCTATCCTTTTAATGCAAAACAGCCGACCG
ACATGGCGAGGCGACAGCAAAAGATCAGCAAGCAGCATCT
TCAAACAGTGAAAGAGCGTTTCCAGGCCTTTCTCAATGGA
GACACTCAGATTGTAGCCGATGAGGCCTTCATCAATGCAG
TCCAAAGCTACTATGAGGTGTTCCTCAAAAGTGACCGCGT
ATCCCGCATGGTCCAAAGCGGTGGATGCTCAGCCAACGAC
TCGCGTGAAGTCTTCAAAAAGCACATCGAGAAGCGTGTCC
GCAGCCTACCCGAGATCGACGGCTTGAGCAAGGAGACGGT
CCTCAGCTCATGGATAGCCAAATTTGACACAATCTACAGG
GGAGAAGAAGACCCACGCAAACACCAGCAGCGCATGACAG
CAAGCGCCGCCTCCGAGCTCATTCTTAGCAAGGACCAGCT
GTATGAGATGTTCCAGCAGATTCTTGGCATCAAGAAGTTC
GAGCACCAGCTGCTGTACAATGCTTGTCAGCTGGACAATC
CTGATGAACAGGCTGCCCAAATCAGAAGAGAACTGGATGG
GCGACTGCAAATGGCTGATCAATTCACAAAAGCTGGCCGC
TTCCCTAAGTTTGTGTCCAGGGACATGGAGGCCATGTACA
TTGAGGAGCTGAAGTCATCGGTGAACCTGCTGATGGCCAA
TCTGGAAAGCATGCCAGTGTCCAAAGGAGGAGAGTTTAAA
CTGCAGAAGCTCAAAAGAGGCCACAACACATCCATCATTG
ACATGGGCCAGGAGGACGAGAACCAGCTCTCCAAGTCTGA
CGTTGTTTTGTCTTTCACACTGGAGGTGGTGATCATGGAG
GTACAGGGTCTGAAGTCTTTAGCACCAAACCGAATTGTTT
ACTGCACCATGGAGGTGGAAGGAGGACAGAAACTTCAGAC
AGATCAAGCAGAGGCCTCTAAACCAACTTGGGGTACTCAA
GGAGATTTCACCACCACTCATCCACTTCCAGCAGTGAAGG
TGAAACTCTTCACAGAGAGTACAGGAGTGCTGGCGCTGGA
GGATAAAGAGCTGGGCCGGGTTGTGTTGCATCCAACACCC
AACAGTCCCAAACAGTGCGAGCTCCATAAGATGACTGTAG
CCAAAGGTTGTTCTGATGACCTGAAGATCAAACTAGCTGT
CCGTATGGACAAACCGCAGAACATGAAGCACTGTGGATAC
CTGTGGGCCATTGGGAAAAACCTGTGGAAAAGATGGAAGA
GAAGATTCTTCGTCTTGGTTCAGGTGAGCCAGTACACCTT
TGCCATGTGTAGCTACAGGGAGAAGAAAGCAGAGCCGGTT
GAACTTCTCCAACTGGACGGATACACTGTGGATTACACCG
ACCCTCAGCCAGGTCTGGATGGCGGTCGGACGTTCTTTAA
TGCTGTGAAGGAAGGAGACACTGTGATCTTCGCCAGCGAT
GATGAGCAAGATCGGATCCTGTGGGTTCAGGCGATGTATC
GAGCCACGGGCCAGTCCCACAAACCCGTCCCCCCGACCCA
AGTGCAGAAACTCAACGCCAAAGGAGGAACGGCACCGCAG
CTTGATGCTCCCATCTCTCAGTTCTATGCAGACCGAGCTC
AGAAACATGGAATGGATGAGTTCATCTCCGCCAATCCTTG
CAATTTTGACCACTCTTCCCTATTTGAGATGGTTCAGCGG
CTCACACTGGACCACAGACTCAATGATTCCTACTCCTGCT
TGGGTTGGTTCAGTCCAGGCCAGGTGTTTGTATTAGATGA
GTACTGCGCCAGGTATGGAGTTCGGGGTTGTCACAGGCAC
CTGTGTTACCTGAGTGATCTGCTCGAGAGGGCAGAGAAAG
GATCCATGATCGACCCCACACTACTGCACTACAGCTTTGC
CTTCTGCGCCTCTCATGTTCATGGCAACAGGCCTGATGGA
ATCGGTACGGTTTTAGTCAATGAGAAAGAACATTTTGAAG
AAATCAAAGAACGACTGCGGGTCCTGCTTGAAAACCAGAT
CACACACTTCAGGTATTGCTTTCCATTTGGACGGCCAGAG
GGAGCCTTAAAAGCCACGTTGTCACTGCTTGAGAGGGTCC
TGATGAAGGACATTGTGACCCCGGTTCCTCAGGATGAGGT
AAAGGCTGTGATCCGCAAGTGTCTGGAGCAGGCAGCTTTA
GTCAATTATCAGCGCCTCTCAGAATATGCCAAGGTGGAAG
GGAAAAAGAGAGAAATGTATGAGCATCCTGTCTTCTGTTT
GGCGTCACAAGTGATGGATTTAACCATTCAAAATGTAGGG
CGCTTAGTCACACCTGCCAAAAAGCTTGAGGACACACTCC
GTCTGGCCGAGCTGGTCATTGAGGTGCTTCAGCAAAACGA
GGAACATCATGCAGAGGCGTTTGCTTGGTGGTCGGATCTG
ATGGTTGAACATGCGGAGACGTTTCTGTCTTTGTATGCTG
TGGACATGGATGCGGCTCTCGAAGTCCAGCCGCCAGACAG
CTGGGACAGTTTTCCTCTCTTTCAGCTGCTCAATGACTAC
CTACGCATTGACTATAATCTGTGTAATGGGAAGTTTCACA
AGCACCTGCAGGATCTGTTTGCTCCTCTGGTGGTGAGGTA
TGTGGATCTTATGGAGTCGTCCATCGCTCAGTCCATTCAC
AGAGGATTCGAACGAGAGTCTTGGGAGCCTGTCAAGAGTT
TAACAAGTAGTCTCCACAGTGTCAACCTCCCAAATGTGAA
TCTACAAATGCCTAAAGTACCAAATCTACAAGTTTCGGTT
AATCTGCCACCAATGCAAATGCCTAGCTTTTCCACATCCA
ACTGGATACCGGGTTTATCAGATACCGACAATGGTTCGGG
GACGTCTGAAGATTTGTTTTGGAAGCTGGACGCTCTGCAA
ACATTCATTAGAGACCTGCACTGGCCAGAAGAAGAGTTTG
CCAAACATTTGGAGATGCGACTTAAACTCATGTCCAGTGA
TATGATCGAGTCCTGTGTTAAAAGAACGAGAGCAGCATTT
GAGCTGAAGCTGCAGAAGAGTCCGAGAACCACAGACTTCC
GCGTCCCTCAGTCCATCTGCACCATGTTCAACGTCATGGT
GGATGCAAAGGTTCAGTCTGCCAAACTGTGTGCCATGGAG
CTCAGCCAAGAGAGACAGTATCACTCGCAAATTGACAATC
TCATCGAGGAGACGGTGAAAGAAATGATTACTTTACTCGT
GGCAAAGTTTGTTGTAATCCTAGAGAGTGTTCTGGCAAAG
TTGTCACGTTATGATGAAGGCACACTCTTTTCCTCCTTCC
TTTCTTTTACAGTAAAAGCTGCTTCAAAATATGTGGATGT
ACCTAAGCCTGGGATGGACGTGGCTGACAGCTATGTGACG
TTCGTTCGCCACTCTCAGGATGTCTTGCGGGATAAGGTCA
ATGAGGAGATGTATATAGAAAGGTTATTTGATCAATGGTA
CACCAGCACAATGAACCTCCTGGGCACGTGGTTGACAGAC
CGCATGGACCTGCAGCTTCACGTCTATCAGCTGAAAATCC
TCATCAGAGTTGTGAAGAAAAAGTATCGTGATTTCCGACT
GCAAGGCGTATTAGACTCAACTCTGAACAGCAAGATGTAC
GAGACTGTGAGAAACAGGCTGATTCTAGAAGAGGCCACAG
CATCTGTGAGAGAAGGAGGGATGCAGGGGATATCAATGAA
AGATAGTGATGAAGAAGACGACTAGATCCTGCTGGAGACA
CTTCAGTCACAGCCACGGTTATCGTGGCCTAAAATAATGC
ATGTACACCACTGTCCATCACTCGTACAGGTCTGGATGTT
GATAAAGTCATGTTTGATGACAGACAAGAGACCAATTTCA
ATTGAAGTGACACAACAATTTATTAATCTCCATTTAGATG
ATGAAAACAACATACTAATTTAAATTTAAATTACTTTTCA
AAAACATTCTGGGTTGTTTCAAGCCACATTTGGGTCAATT
TTTGACATATTGATATTAATAAATGTGATCCTAGACCTCA
AAACCAGTCTAAGGCTGCAGTCACACTGCACATTTCTTCA
CATAGACTTCCATTCATACGCATGCTAATGCGACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations