ZFIN ID: ZDB-TSCRIPT-141209-3273
Transcript Name: si:dkey-31f5.11-202
Previous Names: dkey-31f5.11-001, si:dkey-31f5.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060999 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060999|OTTDARG00000042287|ZDB-GENE-030131-7826 si:dkey-31f5.11|OTTDARP00000047134 DKEY-31F5.11-001 LG_none BX649534.9,BX649263.6 Danio rerio protein_coding NOVEL, 5479 bp
GTCGAGCGTTATGTTAAAGTTTAGTTAAAATCCAGAAGGA
ATGGTTGTTTGTTTTGCGTTTCCAACTACGGTTTCTTGTC
GATCTTCGACTGAGCAGACATGAATGTGTGACTGCAGTAG
GAGCATGCCCATTGCACTTCAACAGCAACTGTTTCTGAAA
TCATATACACATGAGTTGCCTAATTCTTTGACGACTGCCT
GCTGTAGGGTGCTTGCACTCTGCTCTCTAACAATATGCTC
AGCGAGGTGTGACCAGATATTGTGCATCTGAATCCTCCAC
TAGACTACTGATGCAGCCTAGAGAGCGAGGGGAGGAGAGA
GAACAAGTGAGAGAGAGAGAGAGCAAAGCGGATCTCTCTC
CCACACACACACACGCGCGCGCACAGACACAGATCTCGCT
CTCCTGCAGTACAGTGCTGGTGGCTCTTCTGGAATTGTTT
TCTTCTTCTCCTCGGGGAGAAAGGGTTATTTGCTGCCAAA
GCCCGGCGCATCTGGTGGGCATTCCTCTGGAAGTCAGACA
CCATGTGAGCAGTGGCCCGTGACGACATTAGAGGGGCAGA
ATGCTGCTTCTGTACAGGACTCTTGTGGTGTTCTCTCTCT
TCAGTTCAGTCAATGGATTTTTCGGTGGGAATGGGCCAAA
ACCAACAGCCCAAACCAAGGCAGACTCCAAAGGTTGGGGG
CTGCCCTACTTGCCAAACTGGAAACCTCCATCACTTGGTT
TGGGATCATTCAATTTTTTCAACAGGAATAGAGATTCTGC
GGGAACAAAGGTGAGCTTGACCCTTCCAGAAGCAACTACA
CAAGACTATATTCTATCTTCAGAGGACTTAACCACCCTGA
AATACCAGCCGACTGCAACCACAAATGAGGAGCTTCAAAG
CAGCACTGTCCAGATAGGCACCCTGCTGCCTTTAAAATCA
GCAAAACTGCCAACAGATCACTTACTCAGGAACAAACCAC
AATTACAAAGCTCTGACCCACCTCCTTCCATCCTCGATCA
TAGCTATGATCTTGATCTCTGGCCTCCCAATATTGGCCAA
AGTACATCGAAAACACCACAAACAACATCTCCTCAGATTA
CTAGACCACAAACATACACTCTATCCACTGCTCAGAGTAC
CAGCATCACTCAGAATGGTACATTGAGTATGGTTACAGAA
ACCATGAACTCTTACACAGACCAAATCGAACCCACAGACA
CTCCATCAACAACATCAGAACTAACAGAGACTTCATTTCA
AACCACACATTTCGTAACACCAGCAGACCCAAAGCCGGAA
GTATCTACTGATCATCTGACCACTGTCAGCACTGGACAAA
ACACACTGGAGACAACAAATACAGCCTCAAAACCAGAATG
GACAACCTTTGAGCCCACTGAGAAGACTCTGGATGGATTT
ACATGGGTAGAGCAGACCACAAGTCCAACAGAAATGGGAA
AGTTTCGGGAAAGTTTCGGCACAGATTCCACTGCCGCCCT
GCCAGCAGGAGGCTTTGCATGGGAGGAAGGCGATAAGGAC
ACTGCGAAGAATGCTGATCTGACAACACAAAAGCGACACG
ATGAACTGACAACATCAGCTAGCTTCACGACTCTCAGGAA
CACAGAAATGCCCTCCACCGTGTCTGAAGACTGGCTGACA
GACTTTACCCAAGAATCTGCACTCCCTGACTGCAACGCAG
AACGGTCTGGAATTTGCAGTTCTAGTGACACTTGGCCCAC
CACTGTCCTGAGCAACAGCAGCAAAAATGACAGCACAACC
ACGGTCTCCACCAACCTCTCTCAGAGTCCTATACTGTTTC
CAGCCCCACCTATGTTTGTGGCACTGTATTCAGATTGGAA
CAGTGCCCTGGCAACATGGGGTTCAGCGTGGGAAGCCCAC
ATCTACGGCCTGGGCACAGTGTTCTGTCTAGTTGCTTTGG
CCTCCACCCTGAACCTTCTGTGCCTGCCTCTACAGTACCC
ATCAGGCTGTGGCTACTTTGCTCTGGTCAGTTTTTGCCTA
GTTGCAGCTGGCTCCACTAGGGCCTTTGCCCTAGTGTATG
ATGCATATGGATACCAAGACCGTATGTCATCCACAGAGGC
CTCGTTGTTACTTTACGAGGCTCCATTCCCCTGTATGACT
GCTGCCTTTGGCTTAGTGTTCCTTCTCCTATCAATGCGCT
CCCGCATGCAGCTATCCTATTCCGTCTTTCAGAGACCTTG
CATCCTGGCCGGCTTGGTGCTTCTGCACTTTGCTGCTGCC
TTTGGCCCCGTTGCATTACTGCATGTTGACCAACGAGTCT
ACCTGTTTCTGTCCTTGATCTCTAGAGGTGCCTTTGTGGC
TCTGGCAACCTTCCTATCAGCAGCATATTTTGTGTTCTAC
TGCTATGTTCGTGCTGACTCCAAGCATATTTATCATCTGA
ACAACACATCGCCAACACCAGCTGAACGCTACAACCGCTG
CCCATTTGCAGAGAGCCGAGATTGGGACAGAGCTGCAGCT
GCAGTGCTACTCTCTGCCATCTTCTCTCTGGCCTGTGCTG
GTCTGCAACTCTACGCCATGCTACACGCTCTTGGCATGGC
TGGAAGTGTTGAGTCCTTTCGCCCTTGGCCATGGTGGACT
TTCCAGTTCAGCTGCAGAGTGTGTGAAGCAGTGGTTTGTC
TCACACTGGTTCTGGTAGTTGCTCAACCAGTCTACTGTTC
CGATCACCTTCCCCAGGCAGGTAGTTGCTGGACTGAACTT
CTAGCAGCAAAGTCACCAATTATTCCTGGAAGCTATCAGT
GGACTCTATCACATCAGGAGAAGCTTGCTATCTGTGATCC
AATTGGGCATGGGGAGACAGAGTGCCTACCATTGTACACA
CTTGTGGATGACCGTCTAGGCAGCTTAAATGGTCTTGACC
TTTTGTATCACAGCAACCGTGCACTGGCCTACCGTGACCT
TGACCTGGATTTGCCCAACACTCATCCCAACACCGGTGCC
CCTTCTATGGGTTCATCCTGTACAAGTGACTCTACAGCAG
ACCTGCGTCCTCCATCACCTATAAATCTGCGTCGAAGCAT
TGATGAGGCACTTTTTAGTGAGTCTCTATTTCCCATGAGC
ATCTTCAGCCCCTTACGACCCTTCACCTCAAGTGACCGCT
CCCTGAATGGTAGAGAAACCATCTCAAGTGGTGCCCAAAC
AGCGAGAGGCACCCTTATTCCTGATCCAGGGTTATACCGA
ACATCATCATGTGTGGAGGTGCTACCGCAGGCTCCCATTC
CCCCTCAAGCCCAAATGAATGGTCCGTCGTTGGGTTTTCC
TCCATCCCCATCTCCCTCACTCTCATCTTCCACTTGCTGC
TCATCTCCAGAGCGCTGGAGAGGCAGCTCCAGTTCCTCTT
CCCTCTACAGACAGTCTCTGGGTGGTTCTTCTCTAGTTCT
GTGCTCTACTCCAGAAGGACACCATCCTCCATCATCTACC
CTCAGTGGAGGTTCCAGCCACACTGCCAGCTCTGGGCACC
AACGAGACAACGTACAGAGACCCTACAGAACATTAAAGTC
AGAGGACAGTCTGGACCAGCAGTCGGAGTTTGATCAGTCC
GTCCAAGAAGAGTTTATCAGTGTGTGCAGACAGATAGATG
CTCTTAGCATCTGCAGCGAGACTATTGACCTCTAGGGGAG
TCCTCAACTTTCAGACAGAAGAATGATGTAATATGATAAA
GCCAAAAGACTCGGGGTGCTTCTCAAATCATCACTAGGAT
TCCTACTCCAGTTCTTCTAAGGCTTAATTGGTAGAGTCCA
TCTAAGCATAGGACTTAGTACTAGAATGTCAACTCTTACT
ATATGGTCTTGTAAGTGCAAATGGCTGTCATACATTTATC
CACCCTTGCAGTCACTGTGCACAAGTAATATTAAATCCTA
ATCTAAGGGCGAGTATCCACCAAATTGCTAAAAAAGCTCA
GGTGTGAGTGCTACTTCGACTGCCTGGGTTCCTTTTACAA
CAGCAGAAAAAAATGCTCAGCTGGAGAAAAATCTCTTCAG
TAGACATTCACCCTACAGGTGAGGATACATGGTGCAACTT
TTGAGCAATGTTGCTAGGCAAAGTGATTTTGCTTGGATAC
TTTCCTATGAGGAAAGGGCAAGAAATTTGTATCTGGGTCC
AGTTGCACTAGTTAGTTGCCCTGTGTCACACTGGGTTGTC
CATTGATGGCACCATTGGCGAAAGTTCCCCCATGTAACAT
GACCATAAAGATTACTTCATATAAAAATCTTTATATTCAC
CAGTTTTCAGTCAATGCAGTACAAGTAATGACAACTGTCT
GTATTCTCTCAGTGGTTTACATAACACAAGCATTATGCGA
TGCATTTACAACATTGATTTTCATCTCCAAATGTTTTTTG
TTGTTTTTTTGCATTATATAATGGAATTTAATTAGCACAG
TGCTCAGCTTATTTTCAGCTAAGTGTTTGTGAATTGAATG
TGTGCAATAGATTAAGGGTAAACGAAGGATGCCATGAATA
ACACCAGATGTACCCTTCAAAATAGGACACGAAGCAAAGA
CTGCCTACTAAGCATCCTTCTAATTGAGATGTCCTTCAGC
GAAGCTTGATGGCATGGCAGGGTAGATATGCAGCCTTACT
AGGACACATCCTTCCGATTGAGAAGCACCCATGCAGTGAT
GTGATAAGCAGGAAAGGGGCAAATCAGGTGACTTGGTGAG
TGTATTTACCAAGCTGTCAGATGTGTGTTGGACTAGAACT
GTGCCAAATGTTTCAATTTCAGGATGTTTTTGGTATGTTC
CTGTCAGGTAAGTTCTCCAAAGAGATGGATTCTGAAGTCA
ATATCCTTATAAAGGTTTATGAAGTGCCACCACTTGCCAG
AAGCTTAGGCAGATTTTTGTACAAAAGTCCTTTGATTATT
GATAAATTTGTAAGTGTAAAGCATTGCTTTCAAAATTTCT
CTACACTACTAAGAGTGACGTTTGTATCAATTTGTACAAA
ATAGCTTTTTGGTCTATATGATTAATACTGTGAGAGTGCA
AACTACTGATATCCATATTGTAAAACAAATACTACAGAAT
CTAGCTTCAGAAAATGCTATCAATACTGTGTCTAATTTTG
TAATCTGCATCATTTTAGAAACAGTCTTTGTGCTTCTAGT
GTTTAGTCGCACAGGTAACTGCAAGTCACTGTTTATTCGT
TTGTTTGCAATAATGCATTATGACGTCGAAGGGCCTAAAA
AGTTTTATCAAATATGAGGGAGAAAACGTCTCTGTAGTTC
AGTTGTTTTGTAGCACTTAACAAACTGAACTATAGAGCAC
AGACTGCCATTTTATCTTCCTCATAGTGTATATTTGATGA
CAATAATTTATCTGAAATACTCATTACACTGTTGCTCAAT
ACATATTATGACTTTGTACATTTTATAGCGTGCATGAAAA
CTATGTGAGAAACAGCTGATACATCTAATGTTTGTTGTTT
AAAGGCTGTTGGAGATTTTCAATAAATATTAAAAACTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-31f5.11-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000060999 (1),  Ensembl_Trans:ENSDART00000166374 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)