ZFIN ID: ZDB-TSCRIPT-141209-3247
Transcript Name: ankrd13d-202
Previous Names: ankrd13d-001, ch211-10k1.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060916 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060916|OTTDARG00000042229|ZDB-GENE-101007-3 ankrd13d|OTTDARP00000047073 CH211-10K1.6-001 LG_none CT955967.12,BX324205.5 Danio rerio protein_coding NOVEL, 2450 bp
GACACGTCTTGTCAAATGAAATGAACGGTCCATAAATAAA
CGCTCGTGGATTTGTTTGTGTAGATGCAAATGTGGCCGCT
GCCCAAACAAACATTTCATACAAACCGACCTAAATTTTAA
ACTTCATCACTTTACATACAATCCAAACGGCTTTTATCCA
GAATAGCTGAAATGGCTGAAGAGGCGTTTCCTTTACATTA
TCTGGTCTGGAACAATCAATATCTGGAACTGGACCGAGAG
CTTCAGAAAAAGCAGCATGACCTGGAGCGGCTGGATCCGC
GCGGCCGCTCGGCGCTCGAGCTGTCAGTGTGTCTCGGGCA
CCTGGAGTCCACGCGCGTCCTGCTCAGACACAACGCAGAT
CCCACACACAACAACACACAGGGCTGGACAGTTTTGCAGG
AGGCCGTGAGCACTGGAGACCCTGAACTGGTGCAGCTGGT
CCTTCAGTACAGAGACTTCAGAAGAGCCACAGAGAGACTG
GCTGGTATTCCTGAGCTACTGAGCAAACTGAGACAGGCAC
GTGACTTCTATGTGGAGATGAAATGGGAATTCACTAGCTG
GGTTCCTCTAGTGTCGAAAGTTTGTCCAAGCGATGTTTAC
CGTGTCTGGAAAAGTGGTTCATGTTTGAGGGTCGACACCA
CTTTACTGGGCTTTGAGCACATGACTTGGCTAAAGGGCAG
GCGTAGCTACATCTTTAAAGGTGGAGAGAGTGGAGCAATG
GTGATGGAGGTTGACCACGAGAAGCAGGTGGTTTATACAG
AGCCGCTGTCTCTTTCTCCACGTGACGCCCCATCTCTGCT
CGCCGCCATGTTGCCCTCGCAAGAAAACACGGCACAGAGA
CTGACCTCTCCGATAGTGTCCACTCATCTGAACACACGCA
ACATCGCCTTCGAGAGAAATAAGTCTGGGATTTGGGGATG
GCGCTCGGAGAAGACAGAGGTTGTCAGCGGATATGAAGCA
AAGGTTTACAGTGCCAGTAATGTGGAGTTAGTGACTCGTT
CTAGGACTGAACACCTTTCTGATCAGGACAAGTCTAGAAG
TAAAGGATCTAGAACTCCTTTACAGTCGTTTCTGGGTATT
GCTGAGCAGCACATCTCCAGTACTGGGAGTCAGGTTTCTC
AGTGCGCGAGTCCTCATAATCCAACAGCGATCACAGCAGA
GGAGTACTTTGATGCAGAGTTTAACCTGAATGGCAGAGAT
ATTGGCCGGCCCATTGAACTGACCAGCAAAGTGCAGAAGT
TTAAGGCCACTTTATGGTTAAGTGAAGCTCATCCTCTCTC
TCTGGCGGAGCAGGTGACGCCCATCATTGACCTCATGGCC
ATTTCTAATGCCCACTTCGCCAAACTGAGAGACTTCATCA
CTCTCCGTCTGCCACCTGGCTTTCCTGTGAAGATAGAAAT
CCCTCTCTTCCACGTGTTGAACGCTCGAGTGACATTCAGC
AATCTTTGTGGCTGCGATGAACCTGTCAGTTCTGTTACTG
TGCAATCTCCACAAGGAGCAACAGAGGCTGGTGAGACTCC
TCCACCACTGCAGTGTGAAGTGGACCCATCGGTGTTTGAG
CCTCCTCCAGAATACACTACACTTGGACCGGGCCGCAGTG
AGCCAATGAGAGACGAGGATGATAATTTACTCCAGTTTGC
CATTCAACAGAGCCTGCTGGATGCCGGAACAGAGAGTGAC
CAGGTGACTATATGGGAGGCTCTCACTAACACTCGCCCAG
TTTCTCAGCCTCCGCTTTACGAGGAAGACTCTCAGCTGGA
GAGGGCGATTCAGGAGTCTCTGTCGTTGGCTGGAGGGGAG
AGTGGAGAGTCAGACTCGGGCCCACCATTATCCCCATCTG
ATCCCGCTCTCAGTTCACCTCCATGTTACAGCTCTCTGAC
GGAGCCTCGGGCGCCCGGAGCGTTTGCTGTGGCCAGCAGT
TTTGACGAACAGCTACGCCTCGCTATGGAGCTTTCATGCA
GAGAACAAGAGGAGATAGACAGGAAGAGAAGGGAAGAAGA
GGAAGAGCTGGAGAGAATTTTACAGCTGTCTCTAACAGAG
AAGTAACTCCAGTACTGCTACATGTGGGATTTAAAGGAAT
TATTTATTGGTTGTGTTATTATTTTATTTTCTGCAACGTT
AAATTATTCTTTTTCGCTCTTCATTTCTTTTACAAAAATA
ATAAAGATGGGATAGAAAGAGAAACCAAGAGAGAGTGTGC
ACCAAGAACGGATTCAAAGAGCACGGCATGAAAACGTGAA
TGAGATGCTCTCGGTTCCGCTGTCTTCTGAGTGATGAAGG
TCAGCTTCATTGTACAATGATACAGATGAAAATGTGAAAA
TTATTTATGGATACTGATGACTATGGTAATGCATAAAGTA
CTGAAAATACTATTGCATAAAATGAGTTTACTTATGATGG
ATGATAACTACATCTAAGTATTAAATGTTGCTCAAACACT
TTCACAACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankrd13d-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000060916 (1),  Ensembl_Trans:ENSDART00000170784 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH997845 (1) 948 nt
GenBank:EE323169 (1) 776 nt
GenBank:AW422853 (1) 716 nt
GenBank:CD595464 (1) 650 nt
GenBank:FP161554 (1) 615 nt
GenBank:EE205260 (1) 606 nt
GenBank:EE208202 (1) 501 nt
CITATIONS (2)