ZFIN ID: ZDB-TSCRIPT-141209-3246
Transcript Name: si:dkey-83d4.5-001
Previous Name: dkey-83d4.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060913 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060913|OTTDARG00000042228|ZDB-GENE-141216-483 si:dkey-83d4.5|no_translation DKEY-83D4.5-001 LG_ CT955967.12 Danio rerio antisense NOVEL, 769 bp
CCGCCCCACCACGTGACCTGCTGCTGCCGCGGGACAACAG
CGTCATTTAGTGGCAGAAGAGCGAACCTTTTACAGCATAT
CACTCAATTTTCTTCGGCTTTAGTCCTTACTTTATCATGA
GTGAAGAGCGAATAGATTAAAGGCATAAGTCACCCAAAAT
GAAAGTTCTGTAGACATGTATTCACTCTTTACTTGTTTCA
AAACTAACTAGTTTTCTTTTTTTAAATAAAAACCGACATT
TTTAAGAAAGCTGGGAATCTGTAACCTTTGAAAGAGATGT
GTGCACAATTTCCAAGACAAAATCCTGCCCCAACCAGGCA
ATGAATCTTCTGCCCGCTGAATAAAACGAGAAATGAAGGT
AAGGAGCAGGTTGCCCTCTCAAGTGTCACCTTTGAGGACA
GAAACACTGAAGATCAAGATTCTTTAATAGATTGTTCTTT
GAGTCATGAACTTCAGAAAATTGAGCAGAACGTCCAGCTC
CAATTCCATTTCCAGCAAGACATCCAGCTCCAGCAGCCCG
TCCAGCTTCAATTCCAGCAGCCTGCCCTTGATGATCAGCA
GGATCAACATCTGGCTCAAGACTTCAACAGTGACATTTTG
GGCTGCTATAAAATTGTACAAAAGCTTGGTAAGGGAGGAC
ACGGCACAGTCTTCAAAGCGATTTGCTTGATGGACGGTCT
TGAGGAACTACATTTTTACTCACTACATCTTAGCTAAATG
TTTCTCTCACTGCCTGTTCAGGTCCTTTTATTGTGTCACG
TTACATTGA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-83d4.5-001 Contained in:
[BAC] DKEY-83D4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060913 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV485540 (1) 787 nt
CITATIONS (1)