Transcript

si:dkey-27d5.5-201

ID
ZDB-TSCRIPT-141209-3228
Name
si:dkey-27d5.5-201
Previous Names
  • dkey-27d5.5-001
  • si:dkey-27d5.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060852 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060852|OTTDARG00000042184|ZDB-GENE-141216-32 si:dkey-27d5.5|OTTDARP00000047031 DKEY-27D5.5-001 LG_ BX000700.38 Danio rerio protein_coding PUTATIVE, 1020 bp
CAACGGTTCTCTTTGTGTTGTTTTGAACTCCGCTCTGTCA
TTGGCATCTGATCTGGGCGTCCTTCGTGGCAACTGATTCC
CAGATTATTGATATTATTGATTGTTGGATACATCGATTGA
TCGCCTGCTGCTCCCTTCATTCAGGTTTGACCCTTGTTAT
CACACTGTGTTTTGTGTTCAGTATGTCTTGTGTTCATTAC
AGGTTTCAGAGTCGACTCACCTACGACTCGCTCCAGTTTG
AGGGCCTCAACATCACTGTGGGAGAGCTGAAGCGGCGGAT
CATGAGGCGCGAGAGGCTGAAGTTCTGCCAGCTGAAGATC
AGCAAAGCCCAAACTGATGAAGAATACACAGATGATGATG
CTCTCATCCCTAAAAACACATCGGTCATCATCAGACGGGT
CCCTGCGGCTGGACTGAAGTCCTCCAACAGAAGATTTGTT
GGACATCAAGCTGGACCATCAGCTAAATCTTTTCAAACAG
GTGATTCTTTACTCCTCTCACTGGAGCAGCTGTTGAAGAC
TGAGAATCTGGCTGAGGCAAAGGCATCAGAGGAGGACAAG
CTAAAAGCGGTGATGTACCAGTCCAGTCTGTGCTACTACT
CCAGCAGGGCAGCAGCTCTGCTCCGCACAAGCGCATCAGG
AGGAGCACAGGGATTCCCCGCAGCTTCCTGTTGGAGGTGG
ACGACCCAAACCAAAAGGGTGTCATGATGGACGGCAGCGG
CAAATACGTCATTCCCATCATAGACGCTGAGGCCTATGCT
GCTGAGAAGAAAAAGAGGCCGTCCTTCTCCTGCCAGACCA
AGCCGCTGCCCTCCTCTTCCTCAGCTGGTGCAGCATCTTC
AGTCCAGGACGCCAGAGGGAAACGTTCCCGCTCCCCATCT
CCACCAGAGACGCACGGCGACCAGAAGAGACCACGTCACT
GAGAGACCTTCACCCAAGAGACCTGGAGCCGACGTGAGCA
CAGTGTATATATTGTACATAGTTTATGAATAAAACTGAAT
AAAGATTATAGCAGCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations