Transcript

zgc:174355-201

ID
ZDB-TSCRIPT-141209-3227
Name
zgc:174355-201
Previous Names
  • dkey-27d5.8-001
  • zgc:174355-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060849 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060849|OTTDARG00000042181|ZDB-GENE-080214-3 zgc:174355|OTTDARP00000047028 DKEY-27D5.8-001 LG_ BX000700.38 Danio rerio protein_coding PUTATIVE, 1017 bp
CAACGGTTCTTTTTGTGTTGTTATGAACTCCGCTCTGTCA
TTGGCATCTGATCTCGGCGTCCTTCGTGGCAACTGATTCC
CAGATTATTGATATTATTGATTGTTGGATACATCGATTGA
TCGTCTGCTTCTCCCATCATTCAGGTTTGACCCTTGTTAT
CACACTGTGGTTTGTGTTCAGTATGTCTTGTGTTCATTAC
AGGTTTCAGAGTCGACTCACCTACGACTCGCTCCAGTTTG
AGGGCCTCAACATCACTGTGGGAGAGCTGAAGCGGCAGAT
CATGAGGCGCGAGAGGCTGAAGTTCTGCCAGCTGAAGATC
AGCAAAGCCCAAACTGATGAAGAATACACAGATGATGATG
CTCTCATCCCCAAAAACACATCAGTCATCATCAGACGGGT
CCCTGCGGCTGGACTGAAGTCCTCCAACAGAAGATTTGTT
GGACATCAAGCTGGACCATCAGCTAAATCTTCTCAAACAG
GTGATTCTTCACTCCTCTCACTGGAGCAGCTGTTGAAGAC
TGAGAATCTGGCTGAAGCAAAGGCATCAGAGGAGGACAAG
CTAAAAGCGGTGATGTACCAGTCCAGTCTGTGCTACTACT
CCAGCAGGGCAGCAGCTCTGCTCCGCTTAAGCGCATCCGG
AGGAGCACAGGGATTCCCCGCAGCTTCCTGTTGGAGGTGG
ACGACCCAAACCGAAAGGGAGTCATGATGGACGGCAGCGG
CAAATACGTCATTCCCATCATAGACGCTGAGGCCTATGCT
GCTGAGAAGAAAAAGAGACCTTCCTTCTGCCAGACCAAGC
CGCTGTCCTCCTCTTCCTCAGCTGGTGCAGCATCTTCAGT
CCAGGACGCCAGAGGGAAACGTTCCCGCTCCCCATCTCCA
CCAGAGACGCACGGAGACCAGAAGAGACCACGTCACTGAG
AGACCTTCACCCAAGAGACCTGGAGCCGACGTGAGCACAG
TGTATATATTGTACATAGTTTATGAATAAAACTGAATAAA
GATTATAGCAGCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations