Transcript

pla2r1-202

ID
ZDB-TSCRIPT-141209-3214
Name
pla2r1-202
Previous Names
  • pla2r1-001
  • ch211-153g16.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060799 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060799|OTTDARG00000042146|ZDB-GENE-141216-34 si:ch211-153g16.3|OTTDARP00000046983 CH211-153G16.3-001 LG_ CR792451.27 Danio rerio protein_coding NOVEL, 1181 bp
ATCTGCGCTTCTTCCTGTCAGCGTCCAAATTTGTTCGCGT
CGCGGTCAGAACAGACGGGCTGTAAACGGAGAGGGAATAT
TTTGCCTTTTTACTGCCCCACAGAGAGACCGTGACGTAGA
GAATCCAAAAACTTGCGGAAAGTGTGTGGAAAAAACAGGC
TGCCGTCTGTGCAGCGCGCTCGTCTCCTGTGGAAATGCGA
GGATACAGTAAAACTCTTCAAGTTCGCTTCCATGAAGCGC
TTTCTGTCCTTTATGTGCTGCTTTATGTCAGTAATTTCGC
TCTTGCTGCTGCGGAAGTGTCGGACAAAACTGAAGTTTGG
GACAAAACTCAACTTCTCGAAGTGTACAGTAAAGGTGTTT
TCCGGTTGGAGAGTGTATCACAGAAGCGTTGTCTCTCAGC
TGACTCCTCGGGTCTATCGATGTCCAGCTGTGACCCCTCG
TCTCCTGCCCTGCTTTGGAAATGGGTGTCCCGGCACCGAC
TATACAATCTGGGCACCAGTCGATGCCTAGGGATCAACAC
GACCAAGCAGCATGACGTTGGCATCTTTGAGTGCGATGTT
TCCCTCCCAAGCATGTGGTGGCGCTGTGGGGGTGGCATGT
TGTATGGAGCGATGAATAATAAGCTAGTGGCAGTGGACTC
AAAAGTGGTGGTGAGAAGAGGTGCTCTGCATCAGTGGAGG
ATTTTTGGGGCGGCTGGTGAAGGGCCATGTGCTTACCCAT
ATGAAGACATTCACACACTTCAAGGAAACTCTCATGGCAT
GACCTGCTCCATACCCTTCAACTATAACAATAAATGGTTC
TGGGACTGTACCTCAGAGGGCAGAGAGGACCGTCACCTCT
GGTGTGCCACCACCAACCGCTATGATCAAGATGAGAAATG
GGGTTTCTGTCCAAACCCAGTGTCAGGCTGCAATGAATTC
TGGGAGAGCCATCCAGAGCTGAATGCCTGTTACCAGTTTA
ACTTATACTCCATCCTAACCTGGAGCCAAGCTCTTACCTC
CTGTCAAGCGCAAGGTGGAAGTCTTCTGTCCATCACACAG
TCCAGTGAACAGAACTATATCAAAGGAAGACTCTCAGATA
TGGGTGTGATGGTCTGGATTGGATTAAACCATCTCAGTCA
GCACGGGGGATGGCAGTGGTCTGATGGATCTCCTTTGAGC
CTTGTCGGTTATACTGCAGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations