Transcript

slitrk4-202

ID
ZDB-TSCRIPT-141209-3189
Name
slitrk4-202
Previous Names
  • slitrk4-001
  • dkey-263p22.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060714 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060714|OTTDARG00000042087|ZDB-GENE-140303-1 slitrk4|OTTDARP00000046917 DKEY-263P22.1-001 LG_ CR847498.12 Danio rerio protein_coding NOVEL, 4819 bp
TGGAATAGTTGGTTTATAAGACTGGTCTCATTATCCGGAC
GAGGACTGCACCAACAACACTTATTTTAATGATGAGGCGT
AGAGTGGCATCTCTTTTTCGAGCGTATTTTACACAGCTGA
ATTATTAATTTCCTCGTCGGACTGACATCAGAGCACGTAG
TTTCTTTTTTCCTCTTATCTCGCAACTTGCATAATCCCAA
GAAGAGGCAGGAATTCAACTGGAGTCGGTTTCCGATTTTC
GGCAATCGGGTTGAGCCGCGACGCGCGATGGATTGTTGCG
ATTAATTTATTAAGATCTGTATCAGTTTTTTATTTATTTA
TTTTTTCTCCCCTCTTCCGAACTGTTGAGCGAACTGTCCG
TTCAAATAGCCTCCAAACTGATGTTCAGTTCATTCAACGG
AAGAATGTTGGACTTGTTTTGCATCCAAATTTGCCACTTG
CCGTTTCTCCATTTCCACTTCGGGTTTGAAACGATTTCAT
TCTTCAGCGCAAATACGCAGCGCAGTGTTTGAGATGCCTC
AAAAGAGCTCAATAACCTTGGGATTTTATGACACATTATA
TGTTTTGTACAAGTGGAGCTTGACGAGAGAGGCTGAGACT
GAAATTTGAACCTGACTGAATGGGAATAGTCCCTCTCTTG
GCGCTCCCAATGTCCGGTGTAATCTGAAAAGGAGGATAAA
TGAACATTGCCGGTTTCTAAATGGTTTACTGGGGGATTTG
TAAAAGGCAAAATGCTGCTGCTTGTTCTGTTGGCCTTTTC
CATATCGGGTTCATTTTGTGACTTGGATTCGGACCTCAGA
GCTGAGACCTGCAGCGCTTGCTCCTGCATGTCCATCGAGA
ACGTCCTCTATGTGAACTGTGAGAAAATAACTGTGTACAG
ACCTACACAGCTGCATCCGCCAGCATCCAGCCTCTACCAT
TTGAATTTCCAGAACAACCTTTTGTACATCCTTTACCCCA
ACTCTTTTGTGAATTTCACACACGCAGTCTCACTCCAGCT
GGGGAACAACAAACTCCAGAACATTGAGGGAGGGGCCTTT
GTGGGGCTCAGTGCTTTGAAACAGTTGCACTTAAATAACA
ATGAGTTAAAAGAGCTACGTGCTGACACTTTCCGAGGGAT
TGAAAACTTGGAATACCTCCAGGCTGACTACAATTTAATC
AAGTTTATTGAGAAAGGAGCCTTCAACAAATTACATAAAC
TGAAGGTTCTCATTTTAAATGACAATCTAATTCAAAGCCT
ACCTGAGAACATTTTCCGATTCGCCTCCCTTACTCACTTG
GACATAAGAGGGAATAGGATACAGAAGCTTCCTTATCTTG
GGGTTCTGGAGCACATTGGGCGCATAGTGGAATTGCAGTT
GGATGACAACCCGTGGAATTGCACTTGTGATTTGTTACCT
TTGAAAGCTTGGTTGGAAAATATGCCCTATAACATTTTCA
TTGGGGAGGCCATCTGTGAGACCCCCAGTGACTTGTATGG
CCGACTCTTGAAGGAGACTAACAAGCAGGAGCTGTGCCCC
ATGGGTACAGGCAGTGACTTTGATGTACGGATGCCCCCCT
CCCAGCCAGAGGGTGGGCTAACTATGTCTAACGTGGCACC
TTCAACCATAGCACCTTTAGTGACCAAAGCACCCAAAACC
ACCAATCCCTCCAAAATATATGGCAACGGTATTGTCGCTG
GCAACCCAGCTGGTAAAAATGGCCAAATTGTGTCCTATCA
AACACGAATCCCTCCCCTTTCTTGTCCCCAGCCCTGCACG
TGCAAAGCTCACCCCTCTGATTTTGGCATTAGTGTCAGCT
GTCAAGAGAGAAACATCCAGAGCCTGGCAGATCTTATACC
TAAACCACCAAATGCCAAGAAATTGCATCTTAGTGGCAAT
TACATCCGAGATATCAGTCCCACGGACTTCCAAGGGTTTG
AGGGTTTAGATTTATTGCATTTGGGCAGCAATCAAATATC
CACAGTCCAAAAAGGTGTCTTTGCAAATCTCACCAATCTC
CGTAGGCTGTACCTAAATGGAAATCAGCTCGAGCAGCTGC
ACCCTGAAATGTTTCTTGGGCTTAGTAACCTCCAATATCT
CTATTTGGAGTACAATGCCATAAAGGAGGTGTTAGCAGGG
ACATTTGACTCTATGCCAAATTTGCAGCTCTTGTACCTGA
ATAACAATGTGCTCAGAAGCTTGCCTGCGTACATCTTTGC
TGGGGTTTCTCTTGCCAGATTGAATCTAAAGAACAACCAC
TTCATGACTCTGCCTGTGAGTGGCGTCCTAGACCAGCTCA
AATCTCTCACTCAGATAGACTTGGATGGCAACCCTTGGGA
ATGCTCCTGTGATTTAGTGGCTTTGAAACTGTGGCTCGAA
AAACTGAATGAAGGGGTCGCAGCCAAAGGGGTCAAGTGTG
CGTCTCCAGTGCAGTTCTCCAACATTGAGCTGAGAGAGCT
GAAAAATGAGATCATGTGCCCGAAGCTCATAGCCAGGCCT
CCTTTCATCCTGACTAGTGCCACCCCTGTTCTCACATCAT
TGTCACCTGCAGGAGTTGGCAAGGCACCCCCCAGTGGCCC
TGTACCCCTGTCTATTATGATCCTGAGCATACTGGTTGTA
CTGATCCTCACTGTCTTTGTGGCCTTCTGCCTGCTGGTCT
TTGTGCTGAGACGGAACAAAAAGCCAGCAGGGAGACAGGA
GGGTCTCGGCAACCAGGAGTGCGGCTCGATGCCTCTCCAG
ATCAGGAGGCACAATCACAAATCAAACAAGGACGACCTGG
GTGGAGAGACCTTCATCCCACAGACCATCGAGCACATGAG
TAAAGCTCATACGTGTGGAATTAGAGACTCTGATTCAGGC
TACAAATTTATAGACTCAGAGAGACAGAAAATGATGTTAC
GCAACAGTGCAGACCAAGACAAGGACTCTCTATCCCTGGA
CCCCAGGAAGAGATTAAGCACCATCGACGAGCTGGACGAG
TTCTTACCGGGACGAGACACCATGTTTCTTCACAACTTCA
TGGAGAGCAAAAAGGATTTCAGCAGTATAGGGGTGAGTGG
CTTTGAGATCCGTTACCCCGAGAAACCACATGACAAAAAA
ATGAAAAAGTCATTAATAGGGGGCAACCACAGTAAGATAG
TGATTGAACAGCGTAAAAGTGATTATTATGAACTAAAGGC
AAAAATGGGGACCCCAGACTACCTTCAAGTACTAGAGGAA
CAGACAGCCCTCAGTAAATTCTAGAACAGCATCTGCATCT
GTCCCGTAATGACAAAAGTGCCTTAAGACAAATCTTAATG
ACCAATGGAATACCGGACACATTTCATTTACTCAAAGTGT
AACTCCCTTAGAATTGGTGGCTGTGTTAAAAAAAGAAAAA
TCACATACCATGTTTATGTTGTAATGCCATTAAGAATTAA
GAATCACATCAGTCAGTATCTTTACAAAATAGTCATAGTT
TGCTGCTACTGATATGGGTTCCGTCAAATTCTGCTGAACT
TTGTTTTTTTTTACCAAATGATTGGGTCATGAAACGGTGT
TGAGTGTACTTCATATTGACCCTTCTTCATTGTGTTTGGT
TGGAAGTATTTTTAGGCATCTTGGGATGACAAAATCAAAT
GGAGTGGAAGAATTGGAAGTTGGCACATGCTTGAAAGTGG
TGGAATACTGCAGACTCCCCTCTCTTGGATTATATTTTGC
CACTTTTGGGGGACTTGAAACTCTTGGATTTGATTAAATC
TGAAGGTACTGGCAGCCAACATCCGTACACTTTGGATTAT
TCCAATTACTTGTAAAGAGCCATTTGATATTGTTCTACTG
AAATGTGATTCTTCTTGAAGTGTTTGGTTATGGCACATGA
CAGGACATTCATGAACTCAAGAGAAACTAAACAGCTGCTT
GCCATGTAAGCGTATCTGGATTTATTTTGTAAGTCAACAT
TATTTGTATTTGTGGGGCAGTTGTGTAAATTACAACAGTC
GACAATTAAATTCAACAGTCTCATCTGAAGAAAATAGTGG
AAATATGAAAAATCGATAAAAAAGATGACCACTGTCACCA
GTCAATTCGTAGTTTAACTTCATATTTAATTTATTTTTCT
ATGCAGAATTATTTAAAGACTATTGGTACTATTTAACAAT
TTCAAGGGACATTTTGAATGCTATAAGTGATGCAGGCTCT
TAGCCGGAGCTCTAAAATTCTGTTCTGACCTGAGTTACAT
TCTGAATTCTGCTAGTGGCGGATAGATGGCGGTGATGATG
TCATTTTCACTGTCACGTTGCACGAGGTGAGGCCTCCTAG
CGTATCACGTCTAACAGTTTGCTTATTCTTATATCCCAGA
GCAACTTGTAAAACGTTTTTTATTAACAATATGCAACCAA
ATAAGTGTGCATTAACGTGATATGATTCTGGATAGAGCGA
GCGGCATTGTGGAAATGATTCATTTGATGTAATTTATTGG
CTTTGTGGAGAGGATTGTGTTTTATCGACATGACTGTGAG
ACCCAACTCACCTTATAAAAAGGCAGATTTGGTCAGAATC
ATATCACTTTTCATGTGCAATATTATTACGCTCAATCATG
TTAGCTTGAAATCTTATTTTGTTTGTCAGTTCAGATTAAT
ATTGCAGAGAGAAAGCTTGATTTTTTTAAAGGGGAAAGGC
TTATGTTTCATTCAGTCTTTATTTGAAGAATTAAGTTAAC
GATTGTTTATTAGAATGTACCATGAGAGATAAAAATAAAT
ACAATTTTATATCAGTCATGAGAAATCTGTATATTGGTTA
TTAATTTCATTGTGCAATCCTGTTGAGGTCAAGGTATTAA
AATCCAATCTAATTTGCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations