Transcript

si:ch211-195e19.1-201

ID
ZDB-TSCRIPT-141209-3188
Name
si:ch211-195e19.1-201
Previous Names
  • ch211-195e19.1-001
  • si:ch211-195e19.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060707 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060707|OTTDARG00000042081|ZDB-GENE-141216-110 si:ch211-195e19.1|OTTDARP00000046912 CH211-195E19.1-001 LG_ CR559945.12 Danio rerio protein_coding PUTATIVE, 4172 bp
TGTCGACAGCGAGCTCTTAAGCTGTGATCGAAGGAAACGA
AGAACTGAACAACAAAGCATTAATGTTGTTAGTTTGATCA
TTTACAGTGGGGGACGTCTGCTACTACTTACTGCTACTAT
TATTATATATTTATTTATTTGGTTACTCTAGATTTTAAAC
ATCTGAAAAAAGCCTGTTTTCAATTGGCCTGATTTTGATT
ATCACCGTTGTTACTTTGTGCAGACACCGTCTCCCCGAAG
CTCTTCAGGAACACTTCCGTAAACTCGCGAATGCTTGGTA
TATATGCTCGCTGGGCATCGAGTAAAGGTCAATAACCTGG
AAATCTCGTCTTATCTGGATCGAGGCGATCGGGGGAGTTT
GCTGTCATGGATGAGGTGCAGATTCGTCAGTACAGAGAGG
AGGATCTTGAAGAAGTGAAGGAGGTTTTCACTATCGGTAT
GAGTGAACACATCCCGTCATCCTGCATGCACGTCCTCAAG
CAGCCCCTGGCACAGATGTTTCTGGGATGTGTGTTTTGCG
CTTTGCTGACCAGCTCAATGTCCATCCTTTTACCCGTTCT
CGCAGTCACGCTGCTTTTGGCCGCAGGCAGGCAAAGCGTG
TGTTACATGTTCAACAAGTACATCCAGACATCCCTTGAAC
AAGATCTAAGCCACATTCAGCAGACCTACATGGATCCACC
GAATGCCTGCGTCTGGGTTGCCGAAAGCCAAGGTCGTGTC
GTGGGCACAGTTGGCTGCTTTCCTTCAGAGAATGACAAGA
ACTTCTTGGAACTGAAGAGAATGTCTGTTAAAAAGGCTCA
TCGTGGAAAAGGCATTGCCAAAGCGCTGTGCCGCACCGTG
GCTGATTTTGCTCGTGAACGTGGTTATTTAGGAGTAATCC
TGCACACTTCAGTGGTCCAGACAGATGCACAGAAGCTCTA
TGAGCACATGGGCTACCACAAGGTCAGAGAATTTAGTGCT
CCAGAGTTTATTGCCAAGCTGACTAATTTCACACTAATGG
AGTATCAGCTCATCGTAAAACGTCACAACTGAGGATGACG
CCTCTGCAGTTTTGTTCCTGATTAAAAGGGCTTTTTAACG
CTGGTTCAAATCACTAATGAAGCAAACCGCTATCTTCAAT
TGTCTGTTTCTTTCTAAAAAATCCACTTTGGAAAAAGGGA
GGTGTTCTTTTATAAGAAGTTATTTATAAAGGGGGGCGGG
TGAATCAGTTGTCTTATGCAATTTTTTATGTAGTTTTAAA
GCAGAACTTTTTTGTTTATGATTTAAAGCATTAGTTTAAC
CAAATTCTGTTATTATTTGCTTATCTTGTTCCACACCTTC
AGCACTTTTTTTCACCTTCAGAAAACAAATCAGTTTTTTA
ATGAATCAGTTTTATTAACTTTTTAATCAGTTCCTACATT
TTAATCCAAAACATTGAATGTTCAAAGAGAAGTCAAGGTC
AAGGTAAAATGTATTGTCTCCCGTAGGAGAAATTTGTTTT
AGAAAAAAGGTTCTGCTGTACATCGACACTAACAAGAAAA
CATGTAACATACATACACATTAAAATCTAATCCTAAAATA
CCTCCTAATATAAATATGATTCCATAAAATCAGTAATTTT
AATAAATTTTTTATAAAAAAATAAAAAATGATTAAAGTAC
CATATGCCCCACTGCCCTCTGTTGTGCAAACCAATCCTGT
TATCTTAGTCTTTGACCATCCTTCCTTGCTTGCTCGTTGA
TCAACTTAATTGAAAAGGAACAAAAGAATGTTTATATCTA
TTATGCTTGCACAGCGGGACCCTATATCTTCTGCCAGAAT
TCATCAGCTCATATTCCACAGACAGCACATGTGAAGAATC
AGATAAAATCTTGTTGGCTTGTTGGATTGTGCACAACTCA
AAGATGTCTTTTAGTGAACCAAGTGTCTTAATTCCCGTGA
TTTTTCCTGCCACTCTCATCAGGTTATTTACTTGGGTTTT
CATTTTTACTGTCAGATTCCCAAACCAAACAATAATCCCA
TATCTTAAAATAGACTCTATTGTTGCTTTATAAAAAGTCA
TCATTATGCTGCTACTCACTCCAAATAATCTTAGTCTGCG
TAAAAAGTGTAATTGCTGATAAATTCTTGCACAAAGACTT
GACACCTGAGAGTGCCAATTAAGTTCACTATCAATGTTCA
CTCCTAAATATTTATATGAATCAATCTAAAGGGCAGGTTT
TATTCACATATGAACAGCGATCAGAAATCATAATCAGAAG
CCCCACCATATTGACATGAGACGATAACCGTTTTGGAAAA
GTCAAGGTTTTAAAACCGGCAAAATTTTCTTAGGACAACA
GTATCTCCAGCTGAAAAGATCTCCAAAGATGGCGTTTTAG
ATGAAAGAAATCTGTGTGTTTGATTCATTTGATTCAATAA
CTAATTTTAATTATTTAGCCTGACATGTTTACTCCTCTAA
AGTATTTCTTAAAATATTGTGTTTAAAGGGGGAAAAAAGC
GTAATTTTTTCCTCAGACATTTAAAAGAATATATTTTCGA
GCAGTAATCACAGTACCGTGAAACAACCGCGAATATTGGT
ATCCAAGGTTATCACACCTTCAGAATCTTTTATCAGCCCC
ATGCCTACTACCATATATTAATGACATGCGAGACAAACAA
ACCTCAATGGTTCATGAAGCTCAAATGTGACATAAAAGAA
TGAATCGAATTTGTTCTCGTGTCAAAGATCAAATCTGAAG
GCTGTAAACATTGTTTGCTGATAACTGTTTTATGCAAAAC
TCTTTAGAATATCATTCATTTATAAGTTTGCAAATGTTTT
GATGCATTGCATTTTGAGTAAGTAGACTTTGAGGGAATGT
AAAGAAATCACATAGAATTGGTTACAAATGTATGTATCCG
TGTTCTGAAGTTGAATTAAAGTCTAATAAGTCTGAAATGA
CAAGTGAAGATGGAGCCTTTAAAGTGATAGTTCACCCAAA
ATGAAAATGACCTCACCATTTACTCTCCCTCTTTCCTCTG
TTGAACAAAATAAAAGAATATTCTGATGTTTTTTGATACG
GAAGATATTTAGATGTTGGGAAATGCTGGTTGTTTGGACC
AATCGACATTCTTTGTGGAAAAAAAAGCACTATAAAAGTT
AATGGGTAACCAGCATTCTTCAAAATGTTTATTCTTTTCT
GTTAATATGGACCCTTTCCACACTTCCTTTTCATCATAGC
TTGGTAAATTTAGAGCGCAGTGAATGGGAGTGTACAACAT
TTTTTTTTTACAATCTTATTTGCTAAAATAATAAAAGAAA
ACGACCACGATGGTGTAATCAAGACTTTTAGAAAATAAGG
AAATAGTGTGAGACTGATGACGGCAGACAGAGGAGAGAAC
AACATCAAATTTACTCTAAGCCTCATAGACGCTGTGTTAG
AAACACCTCACATAAGCGGTCATTTGTTTTTTAAGTTGAC
GCAAATATGATGTAATACATACATAAATGCATATCAATGT
TTATACGTTTAAAAAAAAATCTAAATATTAAAAACTTTCA
AGGATTTAGGATGTTAAACTTATCATAACAGTCTTTTAAA
AAGGATCCATGGGTTTTGATCAAGGGAAAGGTGACTAAAT
AATAACAGATTTCACTTTTTGGGTTAAACTCTCCCTTTAC
AGAATCAAAACGATGCATTTCTGATCATTTCACCACAGAG
TATTTAACAAGCATTTGAGGGATGTGTTCTTGGAGAAAAT
GCCATAGAGTTTGTAGACCTTGATGTGTTGTTGAAGATCT
TTTTTGTTTATGTATATTTAGAAGTTTCTTGGACTGCGAA
AAACAGCAGTTCCCTGTAAACAAAGTATTTGCATTTGGTC
CGTAATGCAAATGAGATACCCCGAAACCGTCCGATGGTTT
TAACAGGAATTGCTTGCAATGTGAAGGACGTTACATTTCC
ACCTCTCTTAGTATTGATGTTGATTATAATGGCAGCAAGA
GTGTGAAAATTATTATCAGTTTATGCTGGTTAACAAAAGA
ACTGAATCATCTGAGCTTTTTTTCTGTTGTTTTTAATTGA
TGACATAATGAAATGTGATTGTCCTGTGGCTGACTGATTT
CAGTGTAAAACATTCAACGTAACATCCACTCAATATGAAG
ATTTTTTTTTGTAATTTGTTGTAAGAAATCAATAAAATCT
TTTATAAATGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations