header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-3173
Transcript Name: flrt1b-201
Previous Name: flrt1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060648 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060648|OTTDARG00000042054|ZDB-GENE-080327-6 flrt1b|OTTDARP00000046874 flrt1b-001 LG_none CU855924.16,CU929357.6,BX004778.4 Danio rerio protein_coding KNOWN, 7287 bp
CACAGCGAGCCTGACTGACTGAAGACCGACACGGTTAAAA
ATCACAGACAACGACACTGAAGTCACAGAAAAAAACGCGA
TCGTAAAAAGAAGAAAATAAGCCATTCTCTGAATTTACAC
GAAGGAAAGATGCCGTTTACCCGGACGGAGGTTACACGGT
CTCTAAGATGAAGGGTTACAACGTCTCAACGTTCCATCAA
TCTTCATTCACGAAAACACAATCAACATGATGTCAGCTTT
GATGGACACACTACAACTTGAAAACACGTCATCGTCTCGG
ATGTACTCTTGCTGGAGGAAAGTGCTGAACATTTTGCCTG
CTTCTATTGATTGACACTGGAAAAAAAATCCCGGGGGTTT
TTATGCTTGACGTTATGCTTATTTCAGTGCCTACAATTCA
TAGGAATCCTACAATAAAGGGCTGCCATTTTTGTTGGTCA
CTAAAGTCAAAGGACGCAGAGAATCAAGAAGAAAGACCTT
AAGCTTTTTTTTATCAATTTCCAGTCTTGATTTAAAAGGA
CAAGTGACTGTCTAGACCTACAAGCCAAACGACAATGTGG
GACACTTGCTAGATGGGCTTGTGATTGGAAGCAAAGAAAG
CAAAGAAAGAGCTGTGCACCCGGACCAAGAATATTGACTT
CTGAGACATTAAGTTGCATTAACTCTGCAGAGAGAGTGGG
GTACACTGCCTGGAATTATGGCCACGGAGAGCCTTGTTGA
ACTCCGCGACTGGTTGTTTCTACTTCTCCTATGCCTGACG
TTACTTGTTGAAGTGCTGGAGTTTGCTGCAGCTACAGCCG
CCGCGGCTGAAGCAGCTCTCGGGGAAGCGGAGCTACAGGG
AGAAGTGCCATGTCCGTCTGCTTGCAGGTGCGACGATGGA
TTCATTTACTGCAATGACCGTGGCTTGACTCTCATCCCTC
CATTACCATTAACAGCAGCTGTGCTCTATCTCCAAAACAA
CCGCATAGACAATGCTGGGCTACCGACATCTTTAGAGCGA
CGACTGACTGTGAGAGTAGTTTACCTCTATGATAATGAAC
TTGACGATTTTCCGACACACCTGCCTCCGTCGTTACGAGA
ACTTCACCTACAGGACAACAACATACGAACTTTACCGCGT
TCTGCCCTTGCACGGCTCCCCCTGCTGGAGAAGCTTCACA
TGGATGACAATTCAATTTCCACTGTGAGCATAGAAGACAA
AGCCTTCACCAACAATCCGAGGCTGCGTCTTCTTTTCTTG
TCCCGCAACCACCTCTCGAGTATACCATCGGGATTGCCTG
CATCCCTGGAGGAACTCCGTTTAGATGACAATCGCATTTC
AACCATTCCGACGCATGCTTTTCGAGGTCTCTCCTCTCTA
AGGCGTCTCTTCCTGGACGGAAATCTGCTGGCAAATCAAC
GAATTGCAGACGACACATTCTCGCGGCTGTCCAATCTCAC
AGAGCTTTCTCTGGTGCGTAACTCATTACAGGCACCACCG
TTAAACCTTCCAAGTTTGCATCTCCTTAGACTCTATCTGC
AGGACAATGCTATAGCCCACATGCCTCGAGGCTCCCTAGA
TGGCATGCGGAGGCTACAGAAACTAGACATATCTGGTAAT
AACCTAACGACTCTTCCGAGAGGTTTGTTTAAAGATTTAG
ACAGCCTTTCACAATTACTTGTCCGAGGAAACCCATGGTA
CTGTGGCTGCAACCTCCGCTGGCTTCACGACTGGCTGCAT
GAGCGAGGTTCATCTGTGACTGTAAGAGGTTTAACGTGCC
ATGCACCAGAGAGACTAAGAGGCATGGCACTAAGGGACCT
TAGCAGTCAACTGGAAGACTGCGAGGTCACTGTCGACGCC
GCTGGAGGAATGGTTGGAAATGAGGTCGCCAAAAAGGAGA
AGGGTTATTTTCCAACCCAACCACCAGCTACGACGACCCC
CCCACTTCCACAGGGCTCTCTCTTCACTCTCAGATCCAGA
CGACCAGGACACAAGTATTCGGACATGGGTCAGGACAGTC
TCGGAGGTGGAAACGGCTTTGTTAGTAAATCATTACTAAT
CAGTGTAAAGCCTCTCACACCAGAAACAGTCCACATTACA
TGGCAGGCTGCACAGCCAGTGCCCTCCTTCAGACTTTCCT
GGTTGCGATTAGGCAACAGTCCTGCAATGGGGTCAATCAC
AGAAACACTAGTGCCAGGGGATCGCCGTGAGTATTTACTT
ACGCAACTACAGCCCCAGTCCAGTTATATCATCTGCTTGG
TGCCTCTCGCTGGAAACGATGGTAAAAGAACCTCTTTCAC
CGCCACTGGGGGATTAAACATAAACACAAACTCAGAGCAT
GAGCACCCAGCTTGTGCCAAAACAGAAACTGATCCCCTAG
AGCAGCCAATGTCAGATCAGGACAGCGATCGAGGAACTGA
CGCACTGTCAGCCCTACCACTTGCTGGAATAATAGGAGGC
GCGACAGCATTGGTGTCTTTGTTCTTAATTTTTGGCATCT
TCTGCTGGTATGGACACCGTGCAGGGTACCTTGCCCCAGG
TGATCACTCTATATATGGCAGAGATGTAGTCGGATCTCGA
GATGCCAGCAAACATTATGATGACTATGTTGAGTCTGGAA
CCATAAAAGACACATCAATCCTAGAAATCAGGGCTCACGG
CTTTCAAATGACACCAATGTCTGCCCAACAGCCTTTGCAG
CCCAAGGCGAAAGTTGAGGATATGACATACATCCATACTA
TCTTTCCCTCTAATAACGCAACTCTCTATAGGAGCACCCT
GAACCACACAGGAAATCCAAGCTATGGAACAAATCGAGGG
TACAGAGAAGGGGGAATACCTGACATAGATTACTCATACA
CGTGATAGCCTTTTTTATAAACCCTTACCTGTTCTGTCTT
CAGGTAAAGCAGTTGGGTAAGGGCTCTTTTCCCTAGGATC
TACAGTAGGGGTGTGCCGATTCTATGTGAACCGTTTCCCT
CATCCACCAAATACAAAATATTATTACTGGACGTTTTTTT
AATTACAATATTTATATTTTCACACCATTGAAATGTTGGT
ACTGTAACTAGCATTTAAAACAAAAATCAGGATTCTGCCA
TCATTCCCTCACCCTAAACTTGTTCTGAATCAGAGTTCCT
ATTCTGTTGAACACATTTTGAAGAATGTCGGAAATATAGC
CGTTATCTTTAATATTATTTTATGTCATCGGCTGTCTGTT
GAAATATCTTATTTTGTGTTTAACAGAAAAAGAAACTGAA
AGGTACCACTTTAGAGTCAGTAAACGGTGCATAAATTGTC
ATTTTTCTAGGTACTGTCCCTTTAAGTGACTTTACTGCAT
GTATAAAATAGCAAGTAGCTACTTAACCCTTCAAAAATCA
GCTATTAAACGCTATACCATGGGTCTCTGAAGGGCCGCAG
CTCTGCACAGTTTTGCTTTAACCTTAATCAAATACAGCTG
ATCAAACTTATCAAGGTGTTCAAGACTACTATGCTGTTTC
CCCAATTTGTTTACTTCTACTACGCCCTAAAAGTATGTAC
TTTTTTTGTGAACGAAAAGTACATACTTTTGAGTGTGTAA
TAAGGAGTATGCAAGCTTTGGGACATACTACTTCCTCGTT
AACAGATCGTTGTGTTGCTGAGCCCTGTCAATCACCCACA
TTTCTGTCTAATTAATTTTCCTATCTTATTGGATTAAGCA
GCAGCAGGATAATCTGCCATTCACTAGTTTTTCATGCAAA
GAAATATCCTCAGGTCTCTGTATAATCATGCATTCAGACG
TTAATGTCCTAACACGTCTTTATATAAGTTCAGTATTGTT
GTTGTAGATGACATATGACAAAACCTGATTTAAAGGGGTG
GCCCAGGGATGTATTTTTAAGGTTTGGTTGTGTTCATAAG
ATGCAAAGCAAAGTGTGCTCATGCTTCACTTGTAGAAAAT
CACGTTTTTATTTTTTTCCACATATCTTACTTTGATTATA
TACAGCTACTCAGCTAGCATATTTAGTAGTTCCTCCCAAA
GGCCTCTAAATAAATATCTGACAATTGTCTCTCACATATA
TTCGGGTTATAAGCATGTGTAAGTAATATGAAACGTTCAC
ATATCTTTTGCGAGTTTGCTATTTGAGATACGCAGGGAAA
GCGACACTGACATAGACACTGCAGCGCTGCTGAAGATCAT
GTGTTTACAGCAGTTTGACTGATAAAAATAAATTCGTAGC
TAAATTGTTAGCGGTGCCAGACAGCATTTCCCATTGTTTA
CTGTACATCCTTGTTTACATCGTCGCTACAACATACCATT
ACAGAATCTGTGCATGCAATTGATCAATTTTAACAAATGA
AAATACTCACAGGTTGTGGCTCACAATCCACAGCTTTATC
GGTTGGACTAGTTTTTAGCCAAATCCAGCACTGAACAGAT
ATTTTGAAAGCTGCCCTTTGTCAAATGCTAGCTATATATT
TTGTATAATTATCTGGAACATAATTAAAATTAAACTGTTA
GCACTTCCCTCTTTGTGAAGCCCAAATACAGAAACAGACG
AAGCTCTGTGGAAATAGCAGCGTTTGGACATCATTTTAGC
TTTCTTTGCTATAACATTAAATCGCCTCTGATCACGTCCC
ATTGCTGCACAGGGTGAATGCGCATAACCTGAACTATTTG
TTGTCTCACTAACTTGGATGTATAGTTTTTTTATTCCTCA
AACTTCGTTCGTTGTAGGCTTTGCTAAGCTAACTGAAAAA
GCCATGGTCTCCCTTTGCATTGTACTTTGAGCACACTGCA
TTCAGAGATGCTGTTCACGTTCACACAGCTACATTACACA
TCAACTAAAGTTTCCAATATGAAATCATAGTGGACCACCC
CTTTACATATTTTCCAGTTGGTTAGATATTATTTAACAGT
CATAGAAACATCTTTACCAAAGCCTCTCTACTTGATGGTT
GGTCTCGCATGTCCAACATGTTTGTAGTTTATTTACACTT
TTCACTCGCGTTTGTAGTTCTAATCGAATTTACGTCCAAT
TCGCAATGTACTGTGGGCAATATCATCGGTTAGAGTATGG
CCGGTTCTACACTTAAAACTTTTACCGAAATGAGTAAACC
ATCACGTTTGGCATACTTTACCACTACGACATACTACGAT
TTGGGACCTATTAATTTTATTTTCGGGCTTCACGGTATTA
CAGTGAGTAGCATAATCACCTCACAGCAAGAAGGTCCCTG
GTTCAAGCCTTGGCTGAGCCAGTTGGCATTTCTATGTGGA
GTTTGCATGTTCTCCCCGTGTTGGTGTGGGTTTCCTCCGG
GTGCTCCGGTTTACCCCACAAGTCCAAAGACATGTGGTGT
AGGTGAATTGGGTTGGCTTAAATTGTCTGTAGTTTGTGTA
AATGAGTGTGTATGGATGTTTCCCGGTGATGGGTTACAGC
TGGAAGGGCATCCGCTGCATAAAGCATATGCTGGATAAGT
TGGCGGTTCATTCCGCTGTATCTAAACCAGATTTATAAAG
GGACTAAGCCGAAAAGAAATAAATAAATGTATAATTCTAT
TTTCAAATACTATTTGGGATGGATAGTATGCAAATTAGGA
CGCATTATTGTAGTCTTAAACACCTTGTTTAGTTGGATCA
CTTTGATTGGTTGGATCAGCTGTGCTTGATTAGAGCTGGA
GCAAAATTGTGCAGAGCTGTGGCCCTCCAGGAATTGGATG
TGAGACCCATGCGCTATACGGACAGTGTACAGCAGAATAA
CAAATGATGCAATCATTAACACGGCTTCTTAAAGCAGGTT
TTCATTCGGCACACCCCTATTCCAAAGTACCCTTTGTGCC
TCCTTTAGTCTGTTTTCAAAACATCGTTCAAAAAATAGCT
TAAAAACACCTATAATAGTCAGAAAGTGCCAGGGATACCA
CTCTTGGTGTTGATGTTATCCAATTTTCAGATGATAATTG
AAGCTGTTTTTGCATCTTAGTACCAATGATTATCAGTGTC
CTAAAACTAGCTCATGTTAAAGGTTAGCATGATGATGATG
AGACAGGGGACCAGGTTCATATGGATATCGATTTACTACC
TGGACTTTACTGTGTATATATACACACACGTATGCACTGG
GGAGAATAATGCCTTTGCTTTCTGGGGAGATACTGATGAT
GCTTATGATAAAAAACAAATCTTTTTGGGGGTGATATTAC
AAAATCTAATTCTCAGTTCTCTCTCCCTCCTTTTATGGGC
TTTTCCTTTTTTCTCTCTATTTCTTTTGCACGCAGCACGA
GGACTTTGTTCCCAACCCAGGGAGCTGACAGTGGTGATAA
TGGTTTTGACAATGAAAGACCTCAAATTGCTACTGGGTTT
CTTTTCTTTTAATGAGAGTGAGAAAAGTGGGGTAGAAGGA
GACAAAGGGAAAGAGAAGGAAAGAGACGAAGCCACAGAAA
AAGGTTTCATGTTCACAAAGGAAATTTGTCTAAAAAAATA
AGACGCTGAAAAAGTGTATGTCTTATGTTTGGAAGAGAAA
AAAAAAAGAATCACATTTTTCATTCACCGCGGAGGTTTCA
GGAACGGTAAAATGAAATTTGCGAAGCTCAGTAGTTTCAC
CTGCGCAACAAAAGACAGGCGCTTTTAAATGACGAGGAAA
GGAATGACCTGAAGCTAAATAGAAAAGAGGCACTTAAAGA
CAATCATGAAAGGGGTCAACCCTAATTGATGAATCAACCC
AAACTGACAGGCTGACATAGAAAGCGCACTCCATTTAGCA
TGTAAAAAAACACTAAAGGCCAGAGCTTGTTGATCCAGAA
CATACAAGAGAATATCAGGAGAAATTCATGAAAGCAGATG
ATAAACGATGGGATAACATTTTGGCATGTCAGCTCATTAC
AAGCGTTTGTGTGCGAAATGCTGTGTGTATCTAAACCCCT
GAGGTGCAGGAAAAACAGAAATCAGGGATTAATAAAATAT
GTAACACTGTGAACCTCTGCATCTTGTGTGTGGGCTAAGA
AGGAACAGAGAGAACAAAGGTCTTTAACTGATTAAAGACA
ATCCACGTTTGTTTTTTGTTTTTTTCCACGGTCTGACTTT
GTGTGACTTAAACGCAGCATTAGTCGGGAGAGTAGAAATG
TAGGAGGACTAAAATGATATCCGTACCGGATCTGCAATTT
TTCCAGCCTTTTCTGATGCATTTTAAAAGTGAGCTATTCA
AGCAAGTAGTACATGTAAATTTCTTCTTTCTCTTGTTATA
GATATGGAAAACCATCATGATGAATAGTAAACCAAGCTTG
TTATCTTTTTCAGTGATATATGTATCATTAAAAGTTGTGA
TGAAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
flrt1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000060648 (1),  Ensembl_Trans:ENSDART00000114790 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU468745 (1) 1722 bp
GenBank:BM072229 (1) 540 bp
GenBank:AL914975 (1) 539 bp
GenBank:BM185065 (1) 366 bp
CITATIONS (2)