ZFIN ID: ZDB-TSCRIPT-141209-3114
Transcript Name: kdm2ab-201
Previous Names: dkey-83d4.4-001, kdm2ab-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060459 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060459|OTTDARG00000041942|ZDB-GENE-101007-5 kdm2ab|OTTDARP00000046724 DKEY-83D4.4-001 LG_ CT955967.12 Danio rerio protein_coding NOVEL, 7078 bp
ATCATGACAATCTGAAAATGGCGGATGAAAGCGGATTGAT
TTAACTTTATCGAACAAAAATAAGAATATCAAGTGAAGAA
CGACACCATCGCACAGGATGAGTTTGCAGCTCCGCGGGGA
TTTTTAAGCATCCTCCTACACAGCGGCTCCACACTATCGG
CGGAAAGCGAAAGTTGAAGGCTAGAGTATGTCAGAGGCTA
AATCCCGTTATAGCAAACGACTGCGGTCTGGCACACGACG
GCGGTACCAGGATGATGGCATTTCAGATGATGAGATTGAA
GGGAAGAGGTCTTTTGACCTCGAAGAGAAACTCCAGAGTG
ACCGATATAACTCTAATTTGGTCAAAATTATGGATGGGAA
AGACTTCACCTTGGAGTACATCCAACGGGAGGGTCTCCGA
GACCCCATTATCTTCAAGAAAGCAGATGGTCTTGGCATAA
AGATGCCTGACCCAGACTTTAGCGTCAGTGATGTGAAATT
ATTTGTGGGCAGTCGAAGGATGATTGATGTGATGGATGCA
GCCACTCAAAAAGGCATCGAGATGTCAATGGGCCAGTGGA
GGAGATACTACGAGACGCCGGCATCTCAGCGCGAGAAGCT
GTACAATGTCATCAGCCTTGAGTTCAGCCACACAAAATTA
GAGCATCTTGTTAAGAGACCAACCTCGGTTGATATGATTG
ACTGGGTGGACAATATGTGGCCGCGGCATCTTAAAGAAAG
ACAAAGAGACTCCACTAATGCCATTACAGACATGCAGTAC
CCCAAAGTACAGAAGTATTGTCTGATGAGCGTCGAGGGAT
GCTTTACAGATTTCCATATAGATTTTGGAGGCACATCAGT
CTGGTATCACATCCACAAGGGAGGGAAGGTTTTCTGGCTG
ATCCCTCCCACACCTCAGAACCTGGAGCTTTATGAGAACT
GGGTGTTGTCTGCTAAACAAGGCGACATCTTTCTTGGGGA
TAAAGCCTCTATGTGCCAACGGATTGAATTGAAACAAGGC
TACACCTTTATGATCCCCTCAGGCTGGATCCACGCAGTGT
ACACTCCAATGGATACTCTGGTGTTTGGGGGCAACTTTCT
TCACAGCTTCAACATTCCCATGCAGCTCAATATTTTCAAC
ATTGAGGACCGGACACGAGTCCCTTCTAAGTTTCGCTACC
CTTTCTATTTTGAGATGTGCTGGTACGTCTTGGAGCGATA
CTTGTACTGTTTGACCAACACGTCTCACCTCACACCTGAG
TTTCAGAAGCACTCACTCGGGATTGGACTGAAAAAGGAGG
ATGTAATTAAACCAGCTAAACCTGATGGGGATTCTGAAAG
TGAAGATGAGGAGGTGAAGGAAGAGCCGGAAGAAGAGGCA
GTCACTCCTCCTGCCCGTCCCGGGGTGAAAGTTCATCTCG
CACCCTTTGAGTTGGAGGGCCTTTGGGCATTACTGCATAA
GTTGGAGGATTTGCCAGCACACAAGAAATGTGTTCCAGCA
GGCATCAGAAACGCCCCAGCACTGCTTAGCGACATAAGGA
AACTGCTGGAAGAACACGCCAATGATAACCCCAAACTGTC
TTACACTGGAAAACCAATAGTCAAATGGCCCAAAAGGCCG
TCGTGGTATCAGCCGCCGCCGCCACCTCCTCCGTCTCATC
TATACCGGCCACGAACTCCTGGTTCGGGCCCAATGTTGGC
ACCAGTTCCTCGGCCTGTTAAGCCATCTTCCTCCATCTCG
GCTCTGAGACGTAGACGCGTGCGCTGCAAACGCTGTGAGG
CCTGTCTGCGCACTGAGTGTGGCAATTGCAACTACTGTAG
GGACATGAGGAAGTTTGGAGGACCAGGCAGACTGAAGAAG
AGCTGTGTTCTCCGACAGTGTCTTGCACCGGCCCTACCTC
TTACTGCAGTATGTGTCATATGTAAGGAAGGCAACCAGGA
GTCTGATGACACTGAGTCCGTCCAGATGCTCATGGAATGC
TCCGAATGCGCTCAGATCACTCATCCAGAATGTATAAAGG
TTCCAGGTGAGGGTGTTATCAATAAGGACCTTCCCAGTTG
TTGGGAATGTCCTAAATGTGTCCAGGGCAAGAAAACTGAG
TCTTCAAGTAGCAGTGAAGAGGAGACAGACAGCAGTGTAT
CCAACAGCAGTCGATTATCTGGTCCTCCAGCTAAGCGAGC
ATACAGAGAAGGCATTGGGGTGGAGGGCTTGCGTATCGCT
CGCAGAGGTCGTTCCTCAATCTCCCCCTCATCCCTGCCAA
TAACCCGCTCCAGACGCCAGCCACCTCCTTCACAGAGACT
CCTGCTGCAGCACCAGCAGAACCGGAAGAGGGCAGGAGCG
CTGGAATTACAGCTCAGGAAAAGGATCAAATTGGAAAGAA
ACAAAATCCTCCAGTCGCTCCTGCGTCAGCGGAGTCTGGA
GAGGAGGGGTTTAATCAGAGCAGGACCTGGACAAAGCCTT
TCCCGCGGCCGAGGGTCATCCTCCTTCCGTGGCCGAGGGT
TAAGAGTGCGAGGCGGCGGAAGGGGTGGAGGTCTAAGAGA
AAGAATGGAGATGGTGGTAGAAAGAGAGGATTCTGCAGAA
GAAGAACAGCAGGAAAGGAAAGAGAACGGACAGTATAATG
GGAAAGAGAATCGCCCTCAGAGGCTAAGTGGAAAAGCGGG
AGAAGATGAGAATGGCGACGCTCATCGAAATGGAGAGAGC
GAGGAAAGCAGTGAGGGAGGAGAGCCCACTCTGTCTGACA
CTTCTGTAGCACTTACCGATGATGTCAGAGGCCAGGAGTC
TTGCGTCACGGTCAAGTTACAACCATCAAGAGCTAAACGA
GATCCTAGCACCATCGTTCCCAAATTGGAAGCCAACTTGT
CTTCAAGAAGCCTTCCGCCAAACCACAAAGCCCTCCTCCG
CCCCCCGCTCCGAAACGGTGCCCGTTGTTCAGACGCTCCT
CATTCTCCTGGGGACAGATTGCACGTAAACAAATCACATG
CTCTTTCATCATCGTCACACACCCTCACGAGGCGCGCATC
CAAAAACTCAAATCTGAGATCAAACTTTGAAGATTCCACT
CACCGCCTGACTCGAGAGAGAATCCAGAAAAATGCTCGAT
CGGAAAGAGCCAAGTCCTCCGACTCCTGTCCCAGTTCCAC
CTTCCACTCTGGAGGAGGGAATGAGCCAGGCTGGGAGAAA
GAGGTGTGGGTGTCCGTGTTCCGCTATTTGACTCGTGCAG
AGCTCTGCGTTTGCATGGCTGTTTGTAAAAGTTGGTACAA
ATGGGGCTGTGACAAACGTCTCTGGACACGGATCAGTCTG
AGCCGAAGCCGTTCAATGAGTCCGCAGGTCCTGACGGGCA
TCATCAAGCGGCAGCCTGTCACACTGGATCTCTCCTGGGC
AAATATCACAAAGAAGCAGCTCAGTTGGCTCATCAACCGC
CTACCAGGCCTTAAAGATCTGGTGCTATCAGGGTGTAACT
GGTCGTCAGTTTCAGCATTGAGCTCTCCAAGCTGCCCTTT
ACTGCGCTCTTTGGACCTGAGCTGGGCCGATGGCATCAAA
GACGCACAAATCAGGGAGCTGCTGAACCCACCAGGCAGTG
ACAACCGTTCCCAGATGAAGAACATGCAGTGTTTGTGGCT
GTGTGGTCTGGAGGTGACTGAAGCAACGCTGAGGCTGATC
ATCAGACACATGCCTCTGCTCACACGCCTGGAGCTCTCAC
GTTGTCCAATCACAGATGGTGCTCTTAACCTCCTCAGCGC
TGTGGGCTCCTCCACACGCAACACACTCACACACCTCAAC
TTAGCTGGTTGCACCCAGCTGACAGACAGATGTCTGGTGT
ACCTGCGGCGCCTCTCCTGTCTCTCCATACTGGACCTCCG
CGACTGCAAAGGGGTCTCGGTGCAGGCATGCCAAAGCTTT
ATCTCCGAGCTGTCTGTCAATACCCTCTACTACCTATCAG
ATGACAAACTCATCGAGAGGATATCATAAAACCGTGCTCC
TCAGAGAGAGAGAGAGAGAGAGAGAGAGAGCGAGCGAGAG
AGACTTTGTGAATATTGGTGTGTCTCAGAAGGAACTAAAA
TCGTGCGCATGTGCGTGTGGCTTCGGTAGGTCTGTAAGGA
GCTTCTGTGTTGGACAGAGAACCAGGGTTCATGTATAGCA
GCTTTAGGAGGGAGGAGCTCCAAGCATTCTTGGCGGGGCT
TATGTATAAATAGGTGTGGGCGAGGAGGATGCTTTTGTAG
TTTAAACCGTTTCCTTTTGTTTCCGTGTTCACACTGCAAG
CGGCAATCAGATCGGTTCTCAGGCCTGTCATGCCATGGGC
TCTTCTATTCAAGAGATCAACAGGTGCTATTCCTCGACAG
CTTGTTTTCTATTTTTGAGAAGTCTACTTATAAAAACTTG
TACTTTTACTCTAATCCAGTGCTTTTCGATCCTGCTACTT
GAGACTCTGTGCTCTGCACATTTTGTGTTTCTTTTTCTTA
TCTGACCATAATGGAGGGCTGTTTCCATCACAGGAGAATC
TCATTTTAAAAGGTAATTTCAACTTTCTCACAATTCTGTT
TTTTGTTTCCTCTCAAAAATGCAATATATTTCAACTCGGA
GTTGCGAAATAAAAGGTGAAATACTATGATAATTTCTTGC
AGATTTGACTTTCCTGCTGTTATGAGTTTATATTCCTCAA
TTTTTAGGACCACAATTCATTTTTTTAAAGCTTCACTTCT
CAGAAATGCAAAGGAAGAAGTTTGAATTCTGGTTTTATTT
CTCATAATTTTTCCTGAGTCAACATATCTCTAGTTTAATT
ACTGCAGTTCTAACTTTTTCTTCAAGGAATCTGAGTATTT
CAGTAGATCACCTTTTATTTCAAATCTGGGGATTCAGATT
TATTTGTTGTCAGAATTAAGAAACATCCAAATGCCTTTAT
TTTATTTTTTATCCTGTGGTGAAAACGGGCTCCTTTTCTC
GGTTCATTCCTGAAGCTCTCTCTTAAAGAGCTGATGATCT
GAATGGGGTTTGGTAAGTAAAGGGTGGTATATGAAATTTG
CAGAGCGCTGGATCCCCATGACTAGGACTAAAAGCACTGC
TCTGTCACCTAGACATACATTCATTTATCCTAAGTAGTGT
GGAAACATTTGATTTTTGTTTTCTCCGTTCATCCCCTTAC
TTTAAGCATCGTTTTACTTGAGGAATACCTTCTTTTTTGT
AAAATTCCTCTTCCTCCTTAACACCTGAGAGTATAGAGAT
ATATAAATATACTATAAGCACCCTTGTGTAAATGTATTCC
TCTCCTGTAGTAAGAGAAAAGTCTGTAGCATTATAATTTT
CAAAACTTTTCACATTTGTTTTTTTGTTCCTTTTTCAAGC
CAATAAAAATAAGATACAAATGTGACCTTGAGTTGATTTG
AGATGCTGAAATATGAAGTTGTTTTGTTGAATTTGTTTAC
AGTTGGTTATTAGTCCGTTAACCAAATAAAAGTTGTGTGA
TTGGTTCCTAGTTGATTTGCAATACTGGACTTGAATGAAT
TGTTGCATGACGTCTCTGCCTTGAGTTAATATGGTGGGTA
GTCATCAACTTGTCTCTGTATGAAATGCGAATGACATGAC
ACAACTGAACTATCTGTGATATTTTTGCATCGTTGCTGCA
GACATTGTGTAAATTGTGGTCCAATTCATAAATTGTACAT
TTTGGGTAAGGCTATTTTGGTAGACTGTCTAGCACTTGTC
CTCAGGCATTAATATGAACCCATTCATTGTTACTGCCTGG
TGTGTTGAGGAAAGTCTAATTTTAGAAGGCTATATACACC
ATATGATCATCTTAATTTGATGTTTCAATTACTTTTAGTA
TGTCATAATCTGATCTCAAATGAGTTTTCAATTTAGCCAT
ATGCCTTTCTGATTCTATCTGATTGCAAAAATGATCTGAT
CTCTGAAGAGTATAATTTCCTCCCATCCCAGCTCTTATGC
TGTTTGTTCTCAGGTGGGTTTCATAATTCAATATATCCAT
GATTCTATCTGATCTGCAATGATTTTTTTTTACTACTGTA
TATGTCACTATCTGATAACAATAGGCTTTATATATTCAGT
ATTTAACAGTCTGATGTAGACTGATCACAGATGAGCTTAA
ATCCATTCCGATTACATCCAGTCTTTTAAGTAGCACATTC
CTAAATATACTATTATACTTTATACGCAATACGGTCTGAT
CTCATGCGTATGCATTCAAAATGCAGTGCTGTCAGTCTGT
TCTCACTTGAGTTAAGACTCTGTGTTTATATACTGTATGT
CTGATCTCAGAAGTGTTTATTCACATGCCTGTCTGATTAT
CAGATCTCTGATAAGCATGTTTGATATTGGCTTTTTAAAT
TTTTATTATTATTATTATTTTTTTTTAGAGTTTACTGATT
TATCTCAAGGTGCTGTCTGATCTCAGACATGTTTATAAAT
CGCCATGCTACCTGGATTTTAGTCATCTATAGTTTTTTGT
GTGTTTATTTCTAATCAGTTAAATGTACAACAGTCTGATC
TCAGAAGGGTCTTCGCAGATGCTTGTCTGATGTTATTTGT
ATGACACTGTGTTTTTTTAGCAGTTTATAAATTCAGTGCA
TTTTAATCTGATTACAAAGGAGTCTGAATACAGCAACATG
CCATTCTTACATCTGTGCATTTGAAGTTTATAGATTCTAA
ATGTAAATAAGCGTATAAACTCAGCAAATGATCTAGTCTG
ATCTCAGAAGCGTTTATGAATTCACCACATGCTCATCTAA
AATGATTTGATCTTCGATAAATATCCACATCTGATGCATG
ATATGGTTTCAGACATGTATTTCGAGGTGCTATCTGATCT
CAGATGACTTTAGATTTACCAGTAGCTTTAAGATGTCAGT
TCATTTATAATTCATTGTGCAATCCCTCAGTTTTTGAAAT
TCTGTAAACTATGCAGTTTGATACTATCCTTATCTGTGAG
TTTTATGAATTCAGTACATCTCAATCTGATTGTCTGATCT
CAAAATGAGTAAATTCCACAACATAAGAGTGATTTATTCT
GATCCTTTTATTCAGAACAATGTGTTGTCTGATTTCAGGT
TTATGAATATACAACATCTGTCTGATGTTACTTGCTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kdm2ab-201 Contained in:
[BAC] DKEY-83D4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060459 (1),  Ensembl_Trans:ENSDART00000111839 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT730415 (1) 866 nt
GenBank:CT732850 (1) 819 nt
GenBank:CT680298 (1) 748 nt
GenBank:CO356642 (1) 618 nt
GenBank:EB836353 (1) 540 nt
GenBank:AL921551 (1) 537 nt
CITATIONS (2)