Transcript

mcf2l2-202

ID
ZDB-TSCRIPT-141209-309
Name
mcf2l2-202
Previous Names
  • mcf2l2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050912 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050912|OTTDARG00000035767|ZDB-GENE-100812-1 mcf2l2|OTTDARP00000039982 mcf2l2-001 LG_none CR759789.8,CT990625.10,CR450841.7 Danio rerio protein_coding PUTATIVE, 6479 bp
AATAATTAACTAACAAGTCTTGAAACGCCTGAAGAAGAGC
TTTACCTGCAGACAGGAGCGCATCAGGTATCAAAAGACAC
ACAGTTAATGGAGCACAGATGGCGTCTCATCACTGAGTGT
TTCCAAGGAGATGATGTGGTTCCCAAGGGCGATGTCGTCA
AGTAAGATGATAGCCGTTCATCAGCTCACGTCAAAATGTG
GAGAGGAGCCCAGCTCAGTCCTGCTGATGCTGTTCCTCAA
CAACTGCAGGTACCGTTTCCTCTTCTCTGATTCTCTTCCT
GGTGCGTGAAACACACACAGTCTAACAGCCTGACAGGACA
GAAACCAAAGACTCCAGCATCCCTGCATCAACAGCAGACA
CTCACAATGAACCATTAACATCACAAAAAGCTGCACTGCA
GAAAAAAAAAGAGCCGGCTTGATCTGTCCTCCCGCGGAGA
CCTCCATCACGGGCTGGGAGTGGCTGCGGGTCTTTGTGAA
TCAGGGCAGAGAGGAGAGGAGGATTGAGGCGTTCTAGCAT
TCGCACCCTGAGATGCTCTGCAGGTTGGAGGAGGAAGAGG
AGATGTCTCTACTGGAGCTTCAGCAGAGGGTGGACTGTAT
CATCACCCATGTTGATGAGATTATGCAGCAGGAGATCAGG
CCGTTGCTGGCTGTCGACATCATTGAACAACTTCACAGGC
AGTTTGCTCTTCTTTCAGGAGGAAGAGGACAAGAGGGTTC
TCCCATCATCACCTTCCCAGAGTTCTCAGGTTTTAATGAG
GTTTCAGATGAGGATTTTATTAATGTTGTCACTTACCTGA
CCAGCATACCTAGCATGGATGCTGCTAGTATCGGCTTCAT
CATCATCTTGGACCGAAGGAAGGATAAATGGAACTCAGCA
ATCGCTTCTCTGGCACGCATAGCGGGCTCCTTTCCAGGAA
ACCTACAGCTAGTTCTAGTTCTGAAACCTTCGCGCTTCCT
CCAGAGGGCCATCGCTGACGTCAGTATGAGGTTACACAGA
GATGACTTCAAATTGAAGGTACCGATTGTTATGCTAAATT
CCCTGTCTGACTTGCATGGCTACATTGATAAAGGCCAGTT
GACCTGTGACCTTGGGGGAACCCTGGATTATTGCCACAGT
CAATGGATTCATCATCGCACAGCCATTGAGAACTTTGCGC
TGACAGTGAAGAGCACAGCACAGATGCTGCAGCAGTTCGG
AACAGACCTGGCAGAGACTGAACTTCCCAATGACGTGCAG
TGCACCAAAGATTTGCTCATCACACACACTGAAAAACACG
ATAAGCTCAAGGATGAACTAAAATTGGCTGTAAAACAAGG
GAATACTCTGCTGTCCTGTATTAAAGACCAGGCCACCAAA
GCCGAGAGCCACATTTTGAACCCAGACGAGGTTGAGAACC
AAACAACCGTTGAGAGGTTGTTAGCGCAGCTTGATGAGAC
GGAGAATGCATTTGAACAATTCTGGTCAAGACATCACCTC
AAGTTAGAGCAGTGCCTACAGTTACGACACTTTGAGCAGG
ACTTCAAAGAGGTGAAAGTGTCACTGGACGGCCTCTCTGA
AGCTTTGCTGGGACTGTCAGATACCGGGGACTGCGTGGCT
CGTGTGGAACAGCTATTAGGAGAACTGAAAACCTTGGAGG
ATAAAGCTCAGGAGTGTTTGGAGAAAGCTCAGCTTCAAGC
TCAGCATGGGGATCAGCTCATTCAGAGTAATCACTACGCC
ATCGACTCCATCCGCCCCAAGTGTGTGGAACTGCGTCGGA
TCTGTGACGACTTCAGCAACGAGGCCAAAAAGAAGCGTGA
CGTTCTGACCAAATCACTTGAAATCCTCAAACGAATTGAC
GAGGTGAACCAGTGGTGTGAAAGCGGAGTGTATCTGCTGG
CCTCTCAGGCTGTAGACAGATGTCAAACACAGGAAGGTGC
AGAAGCAGCACTGCAGGACATCGAGAGGTACATGAAAACA
GCCAAAGAGCAGCAGCTCAGTCACCTCAAAGAACTCAACA
ACCAGTATGAGGTCGTCCTCTCAGAGCTGCTCAAGAGCAA
AGTTCAAACTGCCTTGAAAACGCTGAACGATGTCCAAGAG
ATGTTTGAGAAAAGACATGCAAGTCTGAAAAAGCTTTCCA
CGAAGCAAACAAGGCCTGTGCAACCTGTTGCACCCCGACC
AGAATCTTCACCAAAACGCCCCTCACCTAAAATCCCACAT
CCCACTCCTCCAACATCACACCGCAAAACTACAGATAACT
CCAGCACCAATAGACAGCCCAGTGATGCAGAACTGGCAAA
AAGAAAAAACATTCGCAAAGCCAAAGGTGGCATTAAGATT
GAGGTCATGCATGAAGGAGGTCAAGGAGGTTCAAGTCATA
TTTTAATGAACAATGAAACTGAAGAGTCGCTTTCAAACAG
ACGCAGTCACATTATGAATGAACTAATTGAGACGGAAAGG
CTGTATGTGGAAGAGCTGCAGAGCATCATAGAGGGCTATG
CCGCGGCACTCGATGACCCAGAACTCATCTATCTGATCCC
ACCATCCCTGGAAAACAAGAAGGAAGTTCTCTTTGGAAAT
CTGCCAGAAATTTACCAATTCCACCAGAAGATATTTCTCA
AAGAGCTGGAAAATTCTGCCGAAAAGCCGGAGTTGGTGGG
AACATGTTTTTTGAAGCGGAAAGAAGAGTTGCAGATTTAT
GAGAAATATTGTCAGAATAAGCCACGCTCTGAAGCTTTGT
GGCGGCAATGCGGGGACAGTATGTTCTTTCAGGAGTGTCA
GAAAAGGTTGGACCACAAGCTTTCATTAGACGCGTATCTG
CTAAAGCCTGTGCAGAGAATCACCAAATACCAGCTTATGT
TAAAGGAGATGCTGAAATGCAGTAAGAACCCAGAAGGCAC
CGCTGAGCTGGAGGAAGCTCAGGCCACAGTGCTGGACATC
ATCAAATCGGTCAACGACTCCATGCATCAGATCGCCATCA
CTGGTTTTGAGGGCAGTTTGAATGATCTGGGGAAACTGCT
TATGCAGGGGTCGTTTAACGTCTGGACAGACCATAAGAAA
GGCCATAGTAAGGTGAAGGACTTGGCACGCTTCAAACCCA
TGCAGAGACATCTCTTCCTCTACCACAAAATGATATTGTT
CTGCAAGAAACGTGAGGAGATGACTGATGGCCATGAAAAA
TCCCCTTCCTACAGTTTCAAGCACTCATTAAAGATGGGCT
CAGTGGGAATCACAGAAAATGTAAAGGGAGACATCAAGAA
GTTTGAAATCTGGTACAATGGCAGAGAAGAAGTTTACATC
ATTCAGGCCCCGTCCATGGACGTGAAGAACACGTGGGTAT
CAGAAATCCGCAAAGTCTTAACAAGCCAGCTGGAAGCCTG
CCGAGAAGCCAGTCAGCTCCATCAGAAGATTACAGAGAAC
ATCTACCATGCCCCCATGAGAAATATGCGTAAAACGGCCC
TCAGACAGTCCGACTCTTCCAGTCCTGAAACAGGCTACAG
ACGCAGTGACTCGGGTCCAAATATGCGTCAGAAACGAGCT
GACACTTCATCCAGCCTCGGCTCAGAGCGAGCGGCTCTTC
CTAGAAAGCGTTTCACCTTACAGGGCCTGTCAAACCGCAG
ATCTCTGCCCGCAGAACCCGCACCTAAGGAGACAGAAGTC
ACTCGCCGCTTTTCTTTAGCCTCAACTGTCGGCTCTGCCA
CTGCTCCACGCACTAAAGCTCCTCTCTCCTCTAGCCTTAA
GAGTAAGAGGCATCAGATCAAGAGCGACCCTACACCATTT
GGCTATGAAGAAACCATGCGAGATTCCCTTCCAGCCGAGA
GAAAAAGTAAAGGTAGCGGCGGTTCGAAGCCCGCTGTGCC
GAGGTCTGCGTCTCAGCCAGGATGGAGTCAACGGCGTCTG
CCTTCAATGGACGCTGAGGATTTCGAGACCATTCCGTCTA
GTGCTGAAGAGCTGTCTATTTCCTCTGATGGAGAGGATGA
AGGACACAACAAAAACGGGGATAATGACCGCTATCAGGTG
CAGTTGACTTACGAGTCTTGCACTGCTCAGGATCTTTCTG
TAGAAGCTGGAGATTTTGTACAATTCCTGGAAGAGTCAGA
GAACGGCCTCTGGCTAGTCAAGAACCTTAGAACTCAGAAG
ACAGGACTGGTGCCGCCCACTGTCCTGCAGTCCACAGCAG
AGGAACTAGACCTTTACAGTAACTCCGATATTTTCAGTGA
CCTCTGCACCGCCGCACTCACCGATACGGAGGACGATATC
GGTGGGACAAATCCTGCTCAGGACGGCAGATTTACATGCT
AAACATCCCATGATGTGTCTTCGATTTCCACAGCACCATC
CTTATCCACAATTTTCTCTACAATGCAATGAGGTGGCATT
ATTTTCCTCTGTTCCTCATCCTGTATTATAAAAGCATCTT
ATTAGAATGAACAAATTACTTTATGCAGACCACAAATAAC
CACACAAACTCAAAACAAGCCTTTCTGCCTCAATAGAACG
TGTGTTGTTATTACTGTATTGTAGGAAATACAAAGAGAAA
TTAATCTGGAGGATTAAATCTCCACACATATGATCGTGAC
ACTAATGTCATTAAAATAGTGAGTGCAATGTTATTTTGAT
GAAAATAAAGCACAAAGCCAAACATACCTCATAGTTTGGG
ATCAATACGATTTTTTAAGTGTTTTTTTTTTTTTAGACTA
TTCCGTTCATCAAGGATTCATTTATTTAATTGGAAAAACA
AATACTGTACAGTAAAAACTGCATAAATTATGAAACATTA
TTACGGTTAATATGATAGTTATCTTAGTGAATGTAACTTT
AAATTGAGTTCATTCATGTGATTTGAGCATCAGTAGTCTC
CATCTACCTTTTTTTCTGGGCATTTTGCATATGCACATAA
AAAAAACAGTTGATGAAAACGCCATGATGCGAATAAATTT
TGAAAATACGCATAAAAAAACTTAAAACGATAATAAAAGA
TGTGCATAAACTACGATGGAAACACTTTTACCGCACAAAT
TTCAGAATGCGCATTAAAAAGATCATGTGATTTTGTGATA
AGAGATCATGTGATGATGAAAATGTGTGTGAATGGACAAA
CCAGCAGGCTGAGCACATTGTAAAACATCTAAAATGTTGT
TTTGGTCATTCTAAAACCGCCTTAACCGTTTCAGTATTAG
TGTTGTTATATTATTAATGACCTCCAGAATCAAGAGCGTC
TGTGCTCCGTGTCTGACACCGTCAAATGCCACTGCACGTT
CACTGCCTGTCAGGATCGCCTTCTGAGGCGCACGTCATTT
ATTAGATGAAGAAAAGATTGCCCAGCTTCTCCTACCTCAG
TAAATTCAGTTTTTTTGCTGTTAATATTTGGCGCCAGTTA
GTCAGGAAGTGGCAATTTTGTTCGCTTTGACTCGTGGGAT
GGAATCGCAGCTTTATTTGAACGTCTTTTATGCGATAATC
CAGTTTTGCAATCCAGTTCTTTCGCATTTTTGGATGGAAA
CATAGCTATGTTATATCATAACATAGCATAATCCTTCAGA
GAAAATTATTATATCCTGATCTGCTGTTCAGGAAACATTT
ATTATCGTTACCATCAACGTTAAAAAAGCTTGGGCTGTTT
CATATTTTTGTGGAAACTGTGTGTCATGGTTGTGGCTTGG
GAAAAAGGAGCGAGGACTCAATTGCAGAAAATAATATGGG
TTGTATTATTAATAATAACATTTTTTAAAAAGGCAAAACA
AACAGATGAACATAATTAACTAATAATGGGTTAACAAGGA
GGGTGGGACTAGACAATAGGCGAGAGAGCACATGACACAG
AGACAACACAAGCCATGTGCTCACATAAATAGGGGCAAAA
ACACGTAGCCAATGAGAGAACTCATTAACCACGTGTTCAC
AATAACAGGACAATGCTAAAGCACGCAGCCACAATGTAAA
CACAGAGCCACGTGCTTGGACAACACAAATAGACGCAAAA
CACAAGCACACCTTACCGTGCACTCAAACATATGCAACGC
GCATGTTTCATCTCAGCGTCAACTAATACAGAAACCAACT
AGACGGAGATGCTGAGAATGAAACAGCGCGATGCCGACAG
AACAAAACACAAACACGAGTACAAGAGTGCGCGCGCACAC
AGAGACACACACAATGACAGAAACAGGACAAGACAGAGCT
AGTGTCCGGACTCTGCCACCAAAACAAGAATCTATAAGAC
CAGAGTGGCAGAACCCTAACAAAAGGACCATTACAATTTA
TTTCTCTTAATTCATCTAGGATACAATAAATTGTTCAAGA
GTGAAAGTATAATAGACATTTAGAATGCGAAAATCTATCA
TATGTATCATACTTTCTGCAAAACTAAAGGCTGATTAAGG
GGCTGAGTGGGGCCTTTTTTAAATGATTTACTAACGGCCA
CAAGCTTTGTGCGTGGTGCTTATGTGCCCTACGCTCTTTG
CATTTTAGTCCTTGCGTGCCGTGCCCTCGTAGTTGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations