Transcript

ints10-203

ID
ZDB-TSCRIPT-141209-3073
Name
ints10-203
Previous Names
  • ints10-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060295 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060295|OTTDARG00000041814|ZDB-GENE-050522-2 ints10|OTTDARP00000046587 ints10-003 LG_ CU856343.8 Danio rerio protein_coding NOVEL, 2649 bp
TTTATTTTGTAAATTCATTGTCTCTACCCGGAAGTTAAAC
AGTGGAGACCCACTGTTCCCGGTGTTTTTCGGTGTTCTGG
TCGTCTGAACGGGTTTATTTGTTACAGTAGAGCCGGTAAC
GGAAGAAAACAGAGCAGATGTCCGCGCAGGGCGACTGTGA
GTTCCTGGTGAAGCGCGCGCGCGAGCTTGTGCCGCAGGAT
CCGTATGCAGCTAAAGCCTGGCTGATCACCGCGCGCACAC
TGTACCCTACTGACTTTAACATACAGTATGAGATGTACAG
TATTGAGCGTAACGCTGAGAGGACGAGCTCTGCTGGCCGA
CTGCTGTACGACATATTCGTGAATTTCCCCGAGCAGCCGG
TGGTGTGGAGAGAGATTTCTGCGATCACGGCGGCCCTGAG
GAACGACAGCCAGGACAAACACGCACAGTTTCTCAAAGGT
GTGTTTGAGACTCTTCCAGGGCAGGTTCAGTGTAAGATGC
TCCTGAAGGCCACAGAACAGTGTTTCAACACACTGGAGAA
GGCAGAGATGCTGCTGCTGCTACTCAAGAGGTTCCCGGAG
TCTGTGGTGCAGCACGGGGTCAGTCTAGGAGAGTCTTTAC
TAGAGGCGGAGTCTGTGGAGGATCTGGAGACGCCCGTCAA
CTGTTTCAGGAAGCTGTTCGTGTGTGACGTTCTGCCGCTG
ATCCTGAATAATCCAGAGATGTGTCTTCCTGTCAGTCTGC
TCTATAAATACTTGCACAAAGCAGCAGAGTTTTACATCTG
TTACGTCACACGGGAGCCGTCGGCGGATGGACAGATGCAG
GGCTCACAGGAAGTGGGCGGTCTGAAGTCTCCAGGACGTG
GGAGGGGCCAACGTTCTGTGATTGACGGGCTGTCAGAGAA
GGCGTCCGTGGTGACGGAGCCGTGGGATAGGCTGCTGGAG
ATGGTGGGCGTGGTCGGCTCGCTCTGTGATTGGCAGGGAG
AGAAAGGAAGCCGGTCGTACGCAGAGCTCCTGCAGCGTGT
GTCAGATCTCTGCAGGTTTTTGTCAGCTGCAGACACAGAC
GGTTTCTCTCGCTGCTGCAGTCAGATCGTCAGCTGCTGCA
CGCTGGTGCTGTTTCACTGCGCCTTCCACTACGTCTCCGC
AGTACAGCCCTCACTGTTCCAGGGTCACTCGTCTCTGAGT
TCGGGTCCGTGGGTTCTGCTGGAGGATCTGTCCAGTGTTT
ACGCTGACGTTGAAGTGGAGAGAAAACACACACACAAGAA
ACGCAAGCTGGCTGACGGACGAGAGAAGACCATGAGCTCT
GATGATGAGGACGTGTTGGCCAAAGGCAGAGGGCGGCACA
TTGTGGTCAGCAAGTCGGAGATGTTGAACTGGGCAGAGAC
GTTGGATCACTTCCGCACGGCCAGAGAGAGCTGGGATCTG
CTGCACTCACACCCGAGCCTGGAGGCCGAGTTTGCGAAGA
TCTGCTCAGCGTGGAAAACTGAGATGTGGCTGTGGTTTCG
CATTTTCCTCACAGATATGATCATCTATCAGGGTCAGTAC
CGTAAGGCTCTATCCAGTCTGGCTCTGATGTCATCACTGC
AGCTCCAGCAGAACCAAAACCAGAACCAGAACTCCCTGCA
GACCGGCTCCAGCTCCAGCCTGGAGAACCACAGAGCCGTC
ATCCAGCAGGCCTCGTGTCACTACGCTCTGGGGGAGTACA
GGCTGGCGTGTGAGAAGCTCCTAGAGGCCGTCGGGGGTTT
GTTACCGCAGAATCAGGAGTTTGTGAAGAACAGCGACGAG
CAGCGCAAACCCCGCAGCAAGACCAGGAGAGGTAATGACC
TGAGGCTCGTCCCCTGCACCAGTAAATCCATCCTCCCCTT
CTGTCTTCAGCTCATGCTGGCCTGTTTTAAACTGAGGGCT
TTCACGGACAACAGGGACGACCTGGCTCTTGGTCATGTGA
TCGTGCTGCTGCAGTTTGATTGGCCGCAGGGTGAAAGTCT
CTTCTTGAAGGCGGTGGATAAGATCTGTCAGCAGGGCAGC
TTCCAGTACGAGAACTTCTTCAACTACGTCACCAACATCG
ACATGCTGGAAGAGTTTGCTTACCTGCGCACCACTGAAGG
GGGGCGTGTCCAGCTTGAGCTACTACCCAATCAAGGGATG
CTGATCAAGAACCCTAGCCCCGCCCTGGGGGTGGAGCTAA
ACACCCTGCTGCTGCCAGGGGCTCAGAAGGCTGACAGGCA
TCACACTGTGACCCGAGGAATCACTAAAGGTGTGAAGGAG
GATTTCCGGCTGGCGATGGAGCGTCAGGTGTCCCGCTGCG
GAGAAAACCTGCTCATGGTTCTGCACCGCTTCTGCATTAA
TGAGAAGATCATCCTCATCCAGTCTTTACCCTGAGTAACC
TCATAAGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTCAGATCGGCTTCACTTAAGA
CATTACTGACTCCATGAACCAAAACGTGAGGTAGGATTTC
ATGTGGGTGAAAATTAGCAGACATTTCCTTTTATTCTCTG
CTTGTACGATGCAGATTACAGCATTTTCTCTTTGTACCAT
TGTAAAATATGTCATGAACCAGACAGTTTTTGTGTAAAAT
AATAATGTTTTGTTGGCAGCTCGTGATAAATAAAACTGTG
TTTTTGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations