Transcript

ctdspl3-201

ID
ZDB-TSCRIPT-141209-3053
Name
ctdspl3-201
Previous Names
  • ctdspl3-001
  • ch211-248i1.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060220 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060220|OTTDARG00000041787|ZDB-GENE-141215-56 ctdspl3|OTTDARP00000046536 CH211-248I1.4-001 LG_ BX323045.14 Danio rerio protein_coding PUTATIVE, 1679 bp
GGGTTTATGTTCTGATTGGCTAAAGCTCGCTTACGTTTGA
TTCAGTTTAAACTGGGGTCAGGCTGTCAGGCTGTCTGGAA
GTGAAAACGGCGAGATCAAACTGATGATTTAATTCATGGA
GATTGATGCGATTCTTGTAATTTTACGGTTTCCCTGAGAG
TTTGAAGTCTCCGTGTCTGTTTATCCGGTCTTTTTAAATC
AGGATTAAAGGAAAATGAGGCTTCGCTCGAGAACTGTTTT
AAACGAAAACACAACGACACCGATTCGCCGCCGCCGAGCC
GCTCCGGAGACACCGAGCCGGGAGAACGAGCCGGTCCAGA
ACCAGGATGACCCAGAGGTTCTTCAAGACTGCTCAAATCT
GGACCCTGATGATGTCCCAACAGCATCCAAACGTCCACGG
AGGAGAAGAAAAGCTTTATCAGCTGTTGTGAATAAAGAGT
CAGGTTTCAAGACTCCAGTCCATCACCTCCGGGAAAGACA
TTCCTCATTGAATCCAGCCGCTCGGAGCCTTTACTCTCCT
GCAGTTCACTTTCTCACCCCCCCAAGAGACCGTGAGCAGC
CAAACACTGGTCCCCTCTTCAGTCCTGAACACCGTGTGTT
TGGTTACAGTGCTGCCAGTCCTCTTTCAGAAGACGAAGAG
AATGAGGAAGTGTTTAGTCCTTTCACATTTATCAAAAACA
TTCCCAACCGTTCCCAACAGTCCAGGCCGGTGTCTGCAGT
GCGGGACATCCCACCAAAGACGAGGAGCACACCTGCTGCC
ACCCTGGTGCTGGATTTGGATGAAACCCTGGTGTTCAGTT
CACTCAATGTGATCCCTGATGCAGAATACACCTTCAATAC
ACGCTTTCAAGACCACAAGTATAAGGTCTACGTAATCCTC
AGACCACATGTGAGAGAGTTTCTACAAGCCATGACAAAAC
ATTTTGAGATGTTTGTTTATACGTCTGCAAAAAAGGAGTA
TGCAGAAAAGATTGTAGATATTTTGGACCCTAATAAAAAG
CTCTTCAGGCATCGTTTGTATCAGGACGACTGCGCCTGTG
TGCTTGGACACTACATTAAAGATTTGACCATTCTAGAAAG
AGACTTGTCAAAGACGGTCATCCTGGACAACGCCCCTCAC
ACTTTCCCATACCACCTGATGAATATGATTCCTATAAAGA
GCTGGATTGGAGATCAAGAGGACCGTGAGCTGCAAAAGCT
CATTCCATACATGGAGAAACTAGTCCACGCGGATGACTTC
AGAAATGTTTTAAAGAAGAGAACCGACCACTTCCACAGGC
TGCTCTCTGAGGACTAAACCCTGGATTAGGTGTAAATACA
TGTACAGCCATCCTAATAAATGCAGTAAAATTGCCCATCT
ACAAGCTAGCTAAGGCTAAATGTGTAGTATGGTGATTCAC
CCTGGTATAACCAAAGTGTTTGTTTGATAGGCGATAGTGT
TAATGCTACCTTTATTCACCCTGGTGATCAGCTGGTGTTC
TGACCCATTTTGAAGATCAGGACTAGAATCCTGCCTTTAA
TTTATTCAACTATGAGATATTGTACAGGTGCCACTGAAAG
TGTGTGTTTTTTACACACTCAACTCTTGTTTTCAATGTGC
GTTGCACTCAGAGCTCTAGTTTTAAAAGTCATTTAGGATG
ATTTTCGGTAACCAATAAATTTTTGTTTCACTGAAGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations