ZFIN ID: ZDB-TSCRIPT-141209-3046
Transcript Name: itih1-201
Previous Names: itih1-001, dkey-33m11.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060198 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060198|OTTDARG00000041771|ZDB-GENE-130530-650 itih1|OTTDARP00000046523 DKEY-33M11.10-001 LG_ CR558302.9 Danio rerio protein_coding NOVEL, 3021 bp
CAACACACACAGGCGCTCATTCATCTGTCTCTCTCTTTTC
ACTCTCATTTAAGAACATCAACAGAGCTGGAGTCAGTCTA
AAGCCATTCAGGACCCAGATTTCACCATGTCTGCAGTGAA
AGTCATGCTATGGATGTTTGTGTTATTTTGCTTGATTTTC
ATTGCCAAAGCTCAAGTCACAATCAAAGATGACAGCAACA
ACTCTGCAAAACAGATTGAACTGCAAAGCATGCGAGTGGA
CTGCAAGGTTGCGTCTCGTTTTGCTCACACCGTCATGACC
ACCAGAGCACTGAACACAGCCAACGCATCGCAGGAAGTCT
TCTTTGAGGTGGACTTACCCAAAACGGCCTTCATAACCAA
TTTTAGCATAGAGATCGAGAACAGGATATATGTAAGTGAG
GTGAAGGAAAAAGAGCAGGCCAGGCAGAAGTATGAGAGCG
CTGTGATATCCGGTCAAACTGCTGGCCTGGTTAAGGCTTC
GGGAAGGCACATGGAGAAATTCTCGGTGTCGGTCAACATC
GCAGCACAAAGCAGTGTCACATTCACTCTTACTTACGAAG
AGCTGCTGCAGAGGCGTCTCGGCAGCTATGAGATCATGAT
AGGTGTCCGACCCAAACAGCTGGTTCAGAACTTTGAGATT
GTGGTAGATATCTATGAACCTAAAGGAATCGCATTTCTGG
ACGTCAACGGAACATTCATCACCAATGAGCTGCTGCCTCT
AGTAAAGAAAACAGTCACGGATAAAAAGGCACATGTGTAC
TTCTCACCAACACTGGATCAGCAGAAAAAATGCTCCAATT
GTGAAGCAACGCTGATTGATGGAGATTTATTCATAAAGTA
TGACGTGAACCATGCACAAGATATAGGTGAAATACAGATA
GTAAATGGCTACTTTGTGCACTTTTTTGCCCCCGAAGGTT
TACCACAAATGCCTAAGAATGTGGTATTTGTGATAGACAG
GAGTGGCTCTATGATGGGAGAGAAGATGAAACAGACTCAA
GAAGCTCTGACGACAATACTAAGTGAACTGCATGAAGATG
ATTACTTTGGGCTGGTCACGTTTGATGACGTTATAGAGTC
ATGGAGACCATCCCTTAGCAAAGCTACACCTGAAAATGTG
ACAGAAGCAAAAGAGTATGTTCAGACTATTAATGCAAGAT
CTATGACTGATATTAACAAGGGAATTTTGTACGCGGTGGA
CATGCTTACCTCAGAAAAAAGTGCTTCTTTCCCAAACATG
TCCATGATAATCCTTCTAACAGATGGACAACCCAGTTCTG
GGGAGCAAGACCTGTCCAAAATCCAAGAAAATGTCCGAAA
TGCTATTAATGGAAGCATGAGTCTCTTTTGTTTGGGCTTT
GGCTATGATTTGGACTACATTCTGCTCGATACGCTGGCCA
AGCAGAATGATGGACTTGCTCGAAGAGTCTATGAGGCCTC
AGACGCTGCGCTTCAACTACAGGGTTTTTATGAAGAAGTG
GCTACTCCACTTCTCATAGAGGTTAATCTAAATTACCCTG
ACAACGCTGTAACAGACGTGACGCAAAGCCACTTTAGACA
TTTCTTCAAGGGCTCTGAGATAGTGGTAGCTGGACGCCTT
CAAGAACTGGAGATCAATGCATTTCCGACTGAAGTATCTG
CAAATGGGTTGGAAGACCAGTTTGTGATGCAGGGTGTAGC
GATTGCTGAAGAGTGGGACAGTGTGTTCCCGGAGCAGGAG
TACATCTTTGGAGATTTCATTGAGCGACTGTGGGCATATT
TGACCATTCAGCAACTTCTGGATAAAAGAGAGAAATGTTC
TCCAGAAGACAAGGAGAACACCACAGCTGAAGCTCTGAGC
CTTTCGTTAAGGTATAACTTTGTCACACCGCTTACTTCCA
TGGTGGTCACCAAACCACAAACTGACGATGAAGAAACACT
CGTTGCTGACAAGCTGACTGAAGAGCAGCGTGAGGACATA
CCACAAGCTGGCATGAGAGCTCCATCTCAGCTGACTGGCA
CTTCTCAACGTCTCAGACAATATTCTCAAGTTCCACTTTT
CGGTGGCACTGCTTCCCAAAGAAGGTTAACACCTTCATCT
TTAGTTGACGGAGATCCACATTTCATCATTGAGCTGCCAG
ATCAGAATGATGCTCTGTGCTTCAACATTGATGACAAACC
TGGAACCATCTTCAATCTGGTTAGAGACCCGCTTACAGGC
ATCATGGTGAATGGCCAGATCATCGGAGATAAGAAGATCA
TCCCAGGGAGCAAGTTGCACACTTATTTTGGCCGCTTTGG
GATTGTTGATGAGAAATTGGGTATCAGACTGATGGTGAGC
ACACAGGAGATCTGGGTGTCCGAAGGAGGAAAACAGACTA
AACTCTCCTGGACGAACAAGAGGACAATAAAAGGACTCGA
TATGGACCTGCAGGTGATCAAAGATCAAAGTTTAACAGTG
ACCCTAAAGAACTCAGTCAAGTTTCTTATTATCCTGCACA
AAATATGGCGGAAACATCCATATCATCAAGACTACCTTGG
GTTCTACACCTTGGACAGTCACCAACTTTCGCAAGATGTC
CATGGCCTTCTTGGTCAATTCTACCACGGCATAAACTTTG
AGGTCAGTGACTTATTTCCAGGAAAGGACGCTGATAAACA
AGATGCCGTTATGTTTGTGAAAAGAAACAAGCTCACAGTT
ACCAGGGGCTGGAAGAGAGATTTCAGACAGGATGTGAAGA
ATGGAGACGACGTGCCCTGCTGGTTCATTCACAACAATGG
CACCGGACTCATCGATGGAGTTCACACGGACTACATCGTC
TCTGGACTCTTCAAGACAATATAGGCAAAATCTGTCTTTT
AACTGACCTTTGCACTATACAGTAATTAACTGTTAGATTT
TATGTAGTCTTAAGTATGTAATATGTGATGGTTGTTGTTT
GGATGTATTGCAGAATCTGACAAAGCTCTATTACAAAGCT
GTTTTTGATAGGATTTAAAGCCATTCAGTAGCTACGAAAT
AAACCACCTACACAAACATGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itih1-201 Contained in:
[BAC] DKEY-33M11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060198 (1),  Ensembl_Trans:ENSDART00000077344 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE717766 (1) 871 nt
GenBank:EB974854 (1) 777 nt
CITATIONS (2)