ZFIN ID: ZDB-TSCRIPT-141209-3040
Transcript Name: arf4a-202
Previous Names: ch1073-165f9.4-001, ottdart00000060180

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060180|OTTDARG00000041758|ZDB-GENE-040801-109 arf4a|OTTDARP00000046508 CH1073-165F9.4-001 LG_ CU638695.6 Danio rerio protein_coding NOVEL, 1609 bp
AAACTACAGGACAAAACACTCTCAGCATCACAGAGAGGAA
AGATGGACAGAAAACATAAGAAAGACTTTTGACCGCGGTT
TAGTTGTGAAGCGCTGAATGCTAAAGCGCTAACTTAGCGG
CTCTTCCTCATTATACTTTATTGCGCCTCGAATAAGTTTA
ACGTTGACACTTTTTCTAGTGTTTGAGCGGTTTTTAAAAT
GGGTTTGACTATTTCGAGCGTATTTTCTCGATTGTTCGGG
AAGAAGCAGATGAGAATTCTCATGGTTGGTCTGGATGCTG
CTGGAAAAACCACAATCCTGTACAAACTGAAACTGGGAGA
AATAGTGACAACAATTCCAACTATAGGAATTTCTGTCGAG
ACAGTCAAATACAAGAACATTTCCTTCACTGTGTGTGATG
TGGGTGGTCAGGATAAGATCGGGCCTCTTATAGGAGACAT
CATTACTTCCAGAACATACAGGGTCTGATCTTTGTTGTGG
ACAGTAGTGATCGTGAACGAGCGCAGGAAGCAGCAGAAGA
GCTTCAGAAGATGCTTCAGGAAGATGAACTGAGGGACGCT
GTTCTGCTGATTTTTGCAAACAAACAAGATTTACCAAATG
CGATGCCCATCAGCGAGTTGACAGACAAACTCGGCCTGCA
GAATCTCAGAAGCAGAACTTGGTACGTCCAGGCGGCCTGT
GCGACTCAAGGGACGGGTTTATACGAGGGATTAGACTGGC
TTTCCGAGCAGCTCTCCAAACGCTAAACTGCACTTCCTGT
TCAAACAGGAAGTGTGTGTTTATGTGTGCTGTTCCAAAGA
ACTTGATGAGCGACGCTGTTTCAGTTGTTACCAAAAATCC
ACCTGCTGATGTCAATCTTTTGGCAGAGCATTTTAGTTTC
TTCTTCTGATTCGTTGCACCTTTTTTGACCTCGACTGACA
TTTCTTTAGATTTATTCCACTTGATGTAGCCCCATACAGT
CAAGCCCGAAATCATTCACACCCCTGGCATATTATGATGG
TAAAGTTGCTTTTATGGTACAGCACGGTGGCTCAGTTTTT
AGCTCTGTCGCCTCGCAGCAAGAAGGTCGCTGATTTGAGT
CCCGGCTGGGCCAGTTTTCTGTGTGGAGTTTGCATGTTCT
CCCCATGTTGATGTGGGAATGATCGACAGGACTTATGGCC
GCCGAGTGAACTGACATTTCTTGAAAGGGACTTCGAACAC
ACACATGCTCTCACAAGCATGCACTCACACACACCTTTTT
ATGTGAATTGTGGGGACATCACATAGGTTTGCATGGTTTT
TATACTGTAAAACTGTATGACTCTAACCCCTACCCTGTCC
CTAAACCACTCACAGGAGGCTGTGCAGTTTTACCTACTAC
AGTACTCATTCTGTATGATTTATAGACCTTTTGAGAAATG
AGGATCAGCAATGTCCTCATAATTCACCATCTTCTTGTAA
TACCTGTTTCATACCCATGTCATTATGTGATTTGTGTCCT
GACACACACACACACACACACACACACATGTTTGTTTTTG
TGAAAAGTGAGTACATTTACGTAGACTTCTATTCATTTTA
TACAGCCCAAACCGTATATTATATTGCCCTAAACCCAACC
ATCACAAGA

arf4a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arf4a-201 (1)    Ensembl 3317
arf4a-202 1609
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arf4a-202 Contained in:
[Fosmid] CH1073-165F9 (1)

Genome Resources: Vega_Trans:OTTDART00000060180 (1),  Ensembl_Trans:ENSDART00000160937 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC155166 (1) 1649 nt
CITATIONS (2)