Transcript

ikbke-201

ID
ZDB-TSCRIPT-141209-303
Name
ikbke-201
Previous Names
  • ikbke-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050745 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050745|OTTDARG00000035640|ZDB-GENE-040718-251 ikbke|OTTDARP00000039847 ikbke-001 LG_ CR848745.16 Danio rerio protein_coding KNOWN, 2508 bp
GGAAGTTCCTGACAGCAATGAAAGGAAAGTTGCTGCTGAG
TTTCCGTCAAGCTGCTCTCTTTACTTCAGTCTGAGGACTG
CAGGTGTAAAAAGTTTGTACAATAACTCAGTTTGGATTGA
AGAGGAAAATGCGTCGCCATCAAACACACAAATGGTCATA
CAGGAAGGAAGTGGACTTTATTCGACTCTTCTGCTCTGAC
TGTTGTGTTTAAGAGAAGTGTTAAGTTCAGGAATAAAACG
GTCCAATTTTGTCTACTTCTGTTAACAAAATGACAAGTAC
AGCAAACTACCTTTGGTCCCAGGAGGATATTCTTGGTCAG
GGGGCGACAGCAAACGTCTATAAAGCACGAAACAAAAAAA
CTGGAGAACTGGTTGCTGTGAAGGTGTTCAACCTGGTGAG
CTACAACAGGCCGTACGAAGTTCAGATGAGGGAGTTTGAG
GTGCTGCAGCTGCTCAATCACGTCAATATTGTTAAACTCT
TCGCTGTGGAGGAGATTATATCGAACCCAAAGCAGAAGAT
TCTTGTCATGGAGTATTGCTCAGGTGGAAGTTTACTGAAC
ATGCTGGAGCAGCCTGAGCATGCGTTTGGACTTCCTGAGT
CCGAGTTCCTCATTGTATTGCATTGTGTGGCTCATGGAAT
GAACCACCTCCGGGAAAATAGTGTGGTGCATAGGGACATC
AAACCTGGGAATATCATGAGGCAAGTGGGTGAGGACGGGC
GCTCCGTGTACAAGCTAGCAGACTTTGGTGCCGCTCGTGA
GTTGGAAGATGATGAGAAGTTTGTGTCCATATATGGCACA
GAGGAATATCTGCATCCGCACATGTACGAGCGAGCTGTGC
TGCGTAGTCCCCAGCAGAAAGCATATGGCGTGTCTGTGGA
TCTGTGGAGCATTGGTGTCACCATTTACCACATGGCTACT
GGTAGTCTTCCATTTAGACCATTTGGAGGACCGCGCAAAA
ACAAGCAGATGATGCACAAGATCACTACAGAAAAACCAGC
AGGAACAATAGCTGGTGTACAGAAGGAGGAAGACGGACCC
ATTGAATGGAGAGACAAACTGCCACTCTCCTGCCAACTAT
CAGAAGGTTTGAAGACCCAGTTGGTCCCGGTGTTGGCCAA
CATACTGCTGGCTGACGATGAGAAGTGTTGGAAATTTCCC
CAGTTCTTTAGTGCCACTAATGACATCCTGAATCGCATCA
CCATCTACATCTTCTCTCTTCAGCAGGCCACAACATACAG
CATCTACATACAATTCCACAACACGGTCTCAATCTTTTTT
GAGGATGTTCAGGCCCAAACTGGAATTGAACCTGCGGCTC
AACAGTATTTATTTCAAGGCCATCCTCTCATATTAGATCC
AAGCATGAAAGTAGTGAACATTCCCCATACCAGCTCAGAT
AAGCCCATGATTCTGATCAGCCGGCGACTGGAAAGGATAA
TTGGATATCCCTTCGAAGAACCTGAATCCCCTCCAATGCC
TGGAAAGTTTGACGTCGTTGCAGATTTTGTTTTCACCAAG
ACCATTGTCAAGGTCATTCATCAGTACCTGCGGATTGCTT
ATTCGCTGCAGGAATACAGGCAATTTATTCTGCAGGGCTT
CAATAGCTACATTGAACAAACAAGCTCTGAAGTCATTGAT
GTGACGCACAGGATTTCTAAAGTGAAAATGAAGCTGCATT
CTTCTATCAGCACAGAGAAAACTCTCCACGTCTTCACTCA
GACTTTTGCACATGAGTTTCCAGACTTTATAGACAGTAAG
AAGAAATTCCCACTGATTGAAGCGGAATTGCAGCAGATGT
GCGGCAGGGGAATCAGAGAATTTCAGAATATACTGCAGTA
TCTGCGTGTGACACTGTCTAAACACTCAGAGACACTGGCC
AATGATAAGAGCATTCAGAAGATGGAGGTTTTGTTGTCGC
AGATTGTTGATGTACATTTCCAGTACTTCAGGGACAGACA
GACAAGAAAGCTCGGCTATAATGACGAACAGATTCACAAG
TTTGAGAAGTTGAATCTGTCTTCATACTTAAAGAAGTTCA
AGAGTTTATTCAAGGATGACTGTTTTCAGAAGTACCTGGA
TGTTCTGAATACCACAGACACGTGTAGCAGGGCTCTGTAT
GACATGCAGACACATCTAGACAAATTCAGAGATACTTTGC
TGCAGAGAATTCAGGATTTGAAGGCACATGAGATCCTGCA
GAACAAGGTTCTGGAAAGAGTTGTGCATCGAGCTGTCCAG
CAGCCAGTTAAAGCCGAGGTGGTGGATGGAAAGAAAAAAG
AAGAGCACATGATTCTCAAAATGACCAGATTAAAGAGTGA
GATGGAGGCTGTGGCATGGGAACTACAGAAAAACAACAAT
ATGATAGAAAGCCTTTCAGTTGTCACCCCTACCATGCCAG
TGGAGAAAAAAAACCCTCAAACCAACAGACCGTGAAGACC
TCAAAAGAATACAGACTGCACCAAAATATTTATATTCACA
AAGCCCAGATCTCTGAGCTAAAAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations