ZFIN ID: ZDB-TSCRIPT-141209-3027
Transcript Name: si:ch211-232f6.3-001
Previous Name: ch211-232f6.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060139 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060139|OTTDARG00000041724|ZDB-GENE-141216-330 si:ch211-232f6.3|no_translation CH211-232F6.3-001 LG_ CR385065.21 Danio rerio antisense NOVEL, 419 bp
GCCTTTTGTTATTTAACACACCCCTTTCCCCGAAAAGATT
CTTGGATTTACTACTTAAGGGAACGTTTCTAAACGTTCGA
TTCTGTTACCCAGATCAGCCCATTTCGTGGAACTTCATGT
TCCATGTTATGTATATTTTGAAGTCAGCTTTAATGACCTC
AAACCAGCCTTAAACCTACCGATACCACCAAACATGTTCC
TATACCCATATCCCACCAGAAGTGTTCTGCAATACATTAT
GCACACGATTCACTACCTATGTTTACTTACAACAAGAAGG
TGAAAAATAAAGATGACTACATCTTATTGACTGACTTCAG
AAGTTCTGGACTCTTATTGCAGTTTTCATTGGCAATCGGC
ATAATACTGACAACTCTACTCTACAAATCACATTTGATGC
TTTGTTGAAAATACTTATT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-232f6.3-001 Contained in:
[BAC] CH211-232F6 (1)

Genome Resources: Vega_Trans:OTTDART00000060139 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)