Transcript

slc25a17-201

ID
ZDB-TSCRIPT-141209-295
Name
slc25a17-201
Previous Names
  • dkey-68o6.9-001
  • slc25a17-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049914 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049914|OTTDARG00000035118|ZDB-GENE-070620-4 slc25a17|OTTDARP00000039169 DKEY-68O6.9-001 LG_ BX569789.4 Danio rerio protein_coding KNOWN, 3459 bp
ATTGTTGACAGGGAAGTCTCATGCAGCTACAAATCTGAAC
ACAGATATCGTGTTATTTGATTTTTTACCTAAATATATAA
ATCTTCCAGTGTCCAAGGATGGGATCTACAGACATGAAAC
TCATGGATGTCTTTTCGTATGAGAGTCTTGTACATGCAGT
CGCCGGTGCGATGGGCAGTGTTACAGCAATGACTGTTTTC
TTTCCCCTTGACACCGCTCGGCTCAGGCTGCAAGTTGATG
AGAAGCGGAAAGCCAAATCAACCCCAGCCATTCTTTCAGA
GATCATCAAGGAGGAGGGTCTGTTGGCTCCATATAGAGGT
TGGTTTCCAGTGATCTGCAGCCTCTGTTGCTCAAACTTCG
TTTACTTCTACTGTTTTCATAGTCTGAAGGCCACTTGGCT
ACAAGGTCAAAGATCAACAGCAGGGCGGGACCTTATTATT
GGCATTGCTGCAGGTGTGGTGAATGTCCTTGTGACCACTC
CACTCTGGGTAGTCAATACCAGACTGAAACTACAGGGGGC
GAAGTTCAGAAATGAGGACATACAGCCCACACACTACAAC
GGAATCAAGGATGCTTTTGTGCAGATCATGCGTCAAGAAG
GAGTAGGTGCTTTATGGAACGGGACGTTTCCCTCCCTGTT
GCTGGTGCTTAATCCAGCCGTGCAGTTCATGATCTACGAG
GGTCTGAAGAGGCAGATCCTGAGGGGCGTCCACAGAGAGC
TCTCCTCAGTGGAAGTGTTTCTTATTGGAGCCGTCGCTAA
GGCCGTAGCAACCACCATAACCTACCCACTCAGACAGTTC
AGTCTGTTCTACGGTTTGGCCAGCACGGGCAGCCTGCAGG
TCAGTCCAGACTCCTGAACAGCCTGAGATCCGTCATGTAT
CTGCTCATCAACAGAGTCAGGAAGTGGGGCATTCTGGGAT
TGTTTAAAGGCCTGGAGGCAAAGCTGCTTCAGACAGTCCT
CACCGCTGCGCTGATGTTCTTACTGTATGAGAAGATCGCA
AGCACCACCTTTAGGGTCATGGGGGTCAAACGACCAATGA
CCTCCCATTGATTTCCAACAGGGCGATTATTGGGAAACTG
GTATGAGTAGTAATCAAATCATGTTTAGTGTTTTATATGT
GAAAGGACTATTCAGTGCCAGTCAGAAGTTATATACTGTA
CAATACACGCTGACTACGTATCAATTTTGGTTTGTTTTGT
TAAATTATATGGTTAATATGACTGGATAGTGAAGGAAACT
CAGCCAAAAAGTGCCAAGAAAGATGAAATGATCAAAAGAG
CTGCTGTGCAAGTGAGAAACATTTAGAATTTTGAAAAGTA
TGAACTCAATTTAAAACAAATAACAAATGTTACTAATTCA
AGTACTGAAATTAATAACTGCTCCATAAAAAGTTAACTTA
ACTTAAGTCCATTAAGTTAAGGTAACTCAAACCATTTTAA
GAAACCCGATTGCAACAAACCATTTAAGTTTAAAAAATGA
ATCCTATTGAGTACTGTGAACATAATCCATTTGAGTAAAG
GAAGCAGTTTGAGCACAGTAAAACCCAATAAATGAAGAGA
ACTCAAATAAGTCTAATAAGATACCTAATTAGTTAAGGCA
ACTCGAACGGTTAGAGGAAACTGATTGCTACAAACCATTT
GAGTTAAAAACTAATCTATATGAGTACTGTGAACTTACTC
CATTTAAGTTGAAGTAATGAGCAATTTAATTAACTCGTTA
CCTTCAACACTGAGTTCAAAACTCTTTTCAAAGTAGTAGA
ATTAACCTTTAGTCAATTTTGAGTTAACTACACTCACTTG
ATAAAGTTGACTGTTGGGTTTTACTGTGTAATAAGGAATT
ATATGAAGCAAATCAATGTAGAAGTATACAGTTGAGGGCC
AAATGATTAGCCCTCCTGTGAACATTTTGATTCTTTTACA
AATATTTATCAAATGATGTTTCACAGAGCAAAGGATTTTT
CCATTTCCTATAATATTCTTTTAAAATAATAAAACATTTC
CTATAATATAATTTTTTTCTTATAGAGAAAATGTTATTTC
TTTTAGTTTGACTGCAGTTTTAAAAAGCGTTAAAACTAAT
TTTAAGGTCAAAATTATTAGCCCAGAATAATTTTCAGAAA
TGATCATTTTTATTTTCAGTTACCTATAGACTTATCTAAT
TAACCTAATTTATCTAGTTGAGCCTTTAATTTGCACTTTA
AGCTCAATAATTATTTTTTAATTAATTAGTAAAATACCAT
GTGCTGTCGTCAGGGCAAAGACAATTTAAATGAGTTATTA
TGAACTAGTTATTCAAATTATTGTTTAGAAATTAGTTGAA
TTTTTTAGTTAAGGAGCACCTAGGAGATATTTTTAAGTAA
TTAAAATTTAATAGGAGGGCTAACAGTTTTTACTTTAAGT
GTGTGTGTGTGTGCGTGTGTGCGTGCGTTCGTGTCTATTA
ATAAAACAATATTAATACATATAAATACCAAAATAACACT
TATTTTATTTATTACAAATTGGTTACTTTAAAAATGAACA
ATATAGAATACTTTTGACATTTGAAAATGTTTTAGTTGTA
CATAATTCTATTTTCCATAGTAATTTTTTACTCTTGCTCA
TAAATGATCATAAAATCATAAAATATCTTTCTTTTGTACT
CTAGGAAATAATATAGATAAAACAAAATAGTTTAAGAATT
CACATGTTTGTATCCATTTTTAATTTAAAATATTTCAATT
CTGTTTTTTGAAATGTGGAAAAAGCAGCGACTGAGTTCAA
ACATTTGACTGATAGTGTTTCAATACAAATGAGTGATTAC
AAATAGGATATACACACACACACTTACTAAAATCAAATCA
ACTCAATAAATTAACACCGTTACATTAAGAGGTCAATAGC
TTGGTCACGATCTAGTGTAGCTTTTTAATAAAGCGTTTGA
TTAAAAAGTATGTGCTAACATGGTTTTAGCAGAACTAAAC
GTGTTTACAAAGTGTCAAAAAGAAAATCAATCCTGTAAAG
GATCTGCTTTTGTGCTGTCAACAAAAAAGAAACAACTTCC
AGACTGGTTTATCTGGTTGTGTGTAAGTGATACTTGATTT
TACTTGACAAACACAAAGCCGCTGAGTCTTTAGTGGACCT
TTAACCTAAAAAGTTTACAGTCTGATCTTTAAAATAGCTT
CCTTCCATCATTCGTGATTGGGACTTGTGGAATAACCTGT
TTATGAGCAGCTTTGGCCAGAATTAACACCTGAACTGTGA
ATGTTACACAAGACACAGAGGCTTATGGGTATCATTTACT
GTATATACATATTTCATTGTCCACACTGCACTAATGTAAT
GTAAGAATCTTTTGCACGGAATTAGCTATTTATGAATGTA
AAATGTTTTTTCTTAATTGTCAGAATGGTTTTATTAACAC
TGAATAATGCAATTGTGAATGATGATTCAAACTATAAATC
ATTTTGTTATATTGATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations