Transcript

zgc:171506-201

ID
ZDB-TSCRIPT-141209-294
Name
zgc:171506-201
Previous Names
  • dkey-68o6.7-001
  • zgc:171506-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049911 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049911|OTTDARG00000035116|ZDB-GENE-080204-96 zgc:171506|OTTDARP00000039167 DKEY-68O6.7-001 LG_ BX569789.4 Danio rerio protein_coding NOVEL, 1295 bp
AATCGGTTGTATAGGCAAACTGCGTTGATTCTTTCACAAA
ATAGCACTTTGTAAAACGGACTTTCTTGATTCACCGGGGA
TCATTTATAGTCGTTACTCGTTAGTATTGTTTTTCGTAAT
TTATTCAGAGAGCAGCATGGAATCTGACAGCGATAGCTAT
GATGAAATGGAAGGTGGACGAAGGAAAATGCCTGAACGAT
TGTGCAAAAAGGGACCTGCCAAGGAAGTGTCGTTCCTGTC
TGGGTTTGAATCAGAAATTTGTCCAGACAGCAGCATGGCA
TCTGACAGTGAGAATTATGAAAAATATGAAGAAAGGGAAG
ATGAAAGAAGCAAAGTGGCAGATCGATTGAGCAAGAAGGG
ACCATCTAGAGACTACAGGCCGAACCATAAAAGAGCTAAA
AACCAACTTCCTGTCACTTGTGGGGAAAAGGAAGGCATCC
TGTGTTTGCGCAAATATAATAATGTGCAGCCATGCATCTT
AAGTGAGGGCCAGTGGTTCACGCCCTCTGAGTTTGAGAGG
TTTGGAAAGAAGGAGAGGAACAAAAAGTGGAAGATCAGCA
TCTTTTATCATAAAATTCCACTTCAGACATTCATAGAGGA
TGGGCTTCTTTCATCTCAACAGTTTCATCACAAGAAAAGC
CGGGTTCAGACTGAAAATGAACAGGGCGGGAGAGAGCTGT
CCTCCTCTGACTCTGATTCTGAACACTCCACTGATGCTCC
AGAGCCTGCTGGATCTTCTGACATAGAGGAGGCTGATCAG
ACTAGTGAAGAACAAGAAGCAGCAGCAGCAGATCCAATGA
GTGAATGCCAGAACCCTATAGATTTACAAGAGACTCCAAA
AACAGACCAGATGCAGTTAATTGAACTTCTGGCTAAACGG
TTTAATACTATGAACAATGCCCTAAAATCAGTAGATTCGT
CTATAAAGACGTTTATGAAAAAATAAATTTAAGACATTTC
TGTTCCGTTCCATACGTAGTATGCATTTTTTTCAAGCTCC
TAGTTGTATAAACGCGAATGCTTATGTTACTGCTGTTGCT
TGTGTCCTGACTTCACTTACTGTTTGTTTCCTGGAGTCTG
GTAGGTTTGCCTGAACCATCAAGCTTTATTGTTTTAATTT
CATTTTCTATCTTGTTTAGTTTGTCTTTATTATACTTTAT
TTGTATTTTTTTTCTTTGTGTTTATGTTTGTTAAGTTAAC
GTTGAATATTTGTTGGAGAATGGGTTTTTTGATTCTTTAT
TTGTTCTTGTTTAGTTATGTGTTTTATTATAATAAATGTA
TTTGTTTTGCTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations